RLG00000023250
ERF Family

P-loop nucleoside triphosphate hydrolase superfamily protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr5
OG0000615
Physical Location & Seq
Forward (+)
20577060 .. 20579725
2666 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000023250

Sequence Viewer

Length: 1020 bp
ATGGGTGGATGTTCGATTGATATTGACTGGGAACTTCCGTTTTCTAATGCTGCTCGCACTGTGGTCTTAGTTGGACGCACTGGTAATGGAAAAAGTGCAACAGGCAATAGCATTCTTGGCAAAAACGCCTTCAAGGCCAAGCGTAGCTCTAGTGGTGTCACGACCACTACTGAATTGAAGACTGCTATCTTGAGAGATGGACAACAAATTAATGTTATAGACACTCCTGGTCTTTTTGATAATTCTGCCAAATCAGACTTTATTGGCAAAGAAATTGCCAACTGCATTAAATTGGCCGACGATGGAATCCATGCTGTTCTTGTGGTTCTCTCAACTAGAACTCGCTTTACAAAAGAAGAGGAGTCTACACTCCGTAGCTTGGAAACTCTATTTGGGAGTAAAAAATTTTACTATATGATTGTTGTCTTTACGAGAGGAGATGAGTTGGAAGAAAATGATGAGACTTTGGAAGATTATTTGGGCCGTGATTGCCTGGAGCCTTTGAAGGAACTCCTTGGTCTGTGTGGAAATCGCTGTGTGCTTTTTGATAACAAGACTAAGGATAAAAGCAAGAGGGTCGAACAAGTGCAGCGGCTTCTCTCGCTTGTAAACTCGGTTACATCACAGAATGGTGGGCGGCCATACACAGATGAGATATTTGCTGAAGCGAAGAAAGGGGCTATGAAACTTCGTGATCAACAAGAAGAGATTGCTTCAAAGGGGTATTCAGAACGAGAAATAAATCTTTTGAATGAGCAGATGCAGCGTCAACATGATCTACAGCTTAAACAAATTACTGAGATGCTTGAGTTAAAGATGGGAGTGAATACCATGACGCTTGAACAAAAGTTAGCAGATGAACATGCTGCACGATTAAGATCTGAACTACAGATTGCCCGAGAGGCTCAACAAAGGTCTGAAAAAGAGAGATATGATCTACAAGCAGAGAAGCGGATATGGATATACGACGGAAACGACAGAGGCCGTATAGGCCTCAGAGACATATGTCCTATTCTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
AIG1

Protein Analysis

340

Amino Acids

38.25

Weight (kDa)

5.89

Isoelectric Point (pI)

41.66

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
AIG1 PF04548 19 - 233 8.4e-79 AIG1 family
MMR_HSR1 PF01926 20 - 129 3.5e-11 50S ribosome-binding GTPase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000615)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G33970 AT1G33970 AT1G33970 AT1G33970 AT1G33970
fragaria_vesca FvH4_5g32530 FvH4_5g32530
malus_domestica MD15G1403700.v1.1
prunus_persica Prupe.1G549700_v2.0.a1 Prupe.1G549700_v2.0.a1
pyrus_communis pycom15g36100
rosa_chinensis RchiOBHm_Chr7g0226331 RchiOBHm_Chr7g0229101 RchiOBHm_Chr7g0229111 RchiOBHm_Chr7g0229141 RchiOBHm_Chr7g0229161 RchiOBHm_Chr7g0229171 RchiOBHm_Chr7g0229211 RchiOBHm_Chr7g0229241 RchiOBHm_Chr7g0229381 RchiOBHm_Chr7g0229761 RchiOBHm_Chr7g0229911
rosa_laevigata RLG00000000796 RLG00000001464 RLG00000001466 RLG00000001469 RLG00000001523 RLG00000001526 RLG00000001529 RLG00000001530 RLG00000001749 RLG00000001913 RLG00000002114 RLG00000002115 RLG00000023248 RLG00000023250
rosa_multiflora Rmu_co8281135.1_g000001 Rmu_sc0000271.1_g000002 Rmu_sc0000271.1_g000007 Rmu_sc0000271.1_g000014 Rmu_sc0000693.1_g000012 Rmu_sc0000693.1_g000015 Rmu_sc0000693.1_g000023 Rmu_sc0001044.1_g000005 Rmu_sc0006689.1_g000007 Rmu_sc0012733.1_g000005
rosa_roxburghii Rroxscaffold_3G00230540 Rroxscaffold_3G00230590 Rroxscaffold_3G00230600 Rroxscaffold_3G00230700 Rroxscaffold_3G00230710 Rroxscaffold_3G00232980 Rroxscaffold_3G00237610
rosa_rugosa Rorug07G0203800 Rorug07G0203900 Rorug07G0256100 Rorug07G0256400 Rorug07G0256400 Rorug07G0256400 Rorug07G0256500 Rorug07G0256600 Rorug07G0256600 Rorug07G0257100 Rorug07G0257200 Rorug07G0257300 Rorug07G0257400
rosa_samantha Rh7DG401100 Rh7DG401300 Rh7DG401900 Rh7DG402100 Rh7DG402300 Rh7DG402700
rosa_wichuraiana Rw0G001910 Rw0G001930 Rw0G001940 Rw7G033790 Rw7G033810 Rw7G033840 Rw7G033900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 365
AciI CCGC 3 cut(s) 592, 637, 952
AcoI YGGCCR 2 cut(s) 294, 638
AcsI RAATTY 1 cut(s) 404
AcuI CTGAAG 1 cut(s) 684
AfiI CCNNNNNNNGG 1 cut(s) 379
AgsI TTSAA 6 cut(s) 133, 178, 505, 717, 751, 842
AjnI CCWGG 2 cut(s) 226, 492
AjuI GAANNNNNNNTTGG 2 cut(s) 375, 407
AluBI AGCT 3 cut(s) 147, 378, 784
AluI AGCT 3 cut(s) 147, 378, 784
Alw26I GTCTC 2 cut(s) 455, 993
Ama87I CYCGRG 1 cut(s) 897
AoxI GGCC 6 cut(s) 135, 294, 481, 638, 982, 991
ApeKI GCWGC 4 cut(s) 50, 589, 763, 866
ApoI RAATTY 1 cut(s) 404
AseI ATTAAT 1 cut(s) 210
AspS9I GGNCC 1 cut(s) 481
AvaI CYCGRG 1 cut(s) 897
BbsI GAAGAC 1 cut(s) 185
BbvI GCAGC 4 cut(s) 37, 601, 775, 853
BccI CCATC 3 cut(s) 191, 296, 811
BceAI ACGGC 2 cut(s) 468, 969
BcgI CGANNNNNNTGC 2 cut(s) 559, 593
BciT130I CCWGG 2 cut(s) 228, 494
BclI TGATCA 1 cut(s) 694
BcoDI GTCTC 2 cut(s) 455, 993
BfaI CTAG 2 cut(s) 150, 336
BfmI CTRYAG 2 cut(s) 779, 887
BglI GCCNNNNNGGC 3 cut(s) 134, 902, 990
BglII AGATCT 1 cut(s) 878
BisI GCNGC 6 cut(s) 51, 590, 593, 638, 764, 867
BlsI GCNGC 6 cut(s) 52, 591, 594, 639, 765, 868
Bme1390I CCNGG 2 cut(s) 228, 494
BmeT110I CYCGRG 1 cut(s) 897
BmgT120I GGNCC 1 cut(s) 481
BmiI GGNNCC 1 cut(s) 498
BmrFI CCNGG 2 cut(s) 228, 494
BmrI ACTGGG 1 cut(s) 37
BmsI GCATC 2 cut(s) 750, 792
BmuI ACTGGG 1 cut(s) 37
BoxI GACNNNNGTC 1 cut(s) 1005
BpiI GAAGAC 1 cut(s) 185
BpmI CTGGAG 1 cut(s) 515
BpuEI CTTGAG 2 cut(s) 211, 827
BsaBI GATNNNNATC 1 cut(s) 877
BsaJI CCNNGG 1 cut(s) 514
Bsc4I CCNNNNNNNGG 1 cut(s) 379
Bse1I ACTGG 2 cut(s) 32, 85
Bse8I GATNNNNATC 1 cut(s) 877
BseBI CCWGG 2 cut(s) 228, 494
BseDI CCNNGG 1 cut(s) 514
BseGI GGATG 1 cut(s) 14
BseJI GATNNNNATC 1 cut(s) 877
BseLI CCNNNNNNNGG 1 cut(s) 379
BseMII CTCAG 2 cut(s) 789, 1009
BseNI ACTGG 2 cut(s) 32, 85
BseRI GAGGAG 2 cut(s) 374, 450
BseXI GCAGC 4 cut(s) 37, 601, 775, 853
BsgI GTGCAG 2 cut(s) 608, 852
BshFI GGCC 6 cut(s) 137, 296, 483, 640, 984, 993
BsiHKCI CYCGRG 1 cut(s) 897
BslI CCNNNNNNNGG 1 cut(s) 379
BsmAI GTCTC 2 cut(s) 455, 993
BsmI GAATGC 1 cut(s) 111
BsnI GGCC 6 cut(s) 137, 296, 483, 640, 984, 993
BsoBI CYCGRG 1 cut(s) 897
Bsp143I GATC 4 cut(s) 694, 775, 878, 934
BspACI CCGC 3 cut(s) 592, 637, 952
BspANI GGCC 6 cut(s) 137, 296, 483, 640, 984, 993
BspCNI CTCAG 2 cut(s) 790, 1008
BspLI GGNNCC 1 cut(s) 498
BsrI ACTGG 2 cut(s) 32, 85
BssECI CCNNGG 1 cut(s) 514
BssMI GATC 4 cut(s) 694, 775, 878, 934
BssT1I CCWWGG 1 cut(s) 514
Bst2UI CCWGG 2 cut(s) 228, 494
Bst4CI ACNGT 1 cut(s) 61
Bst6I CTCTTC 2 cut(s) 351, 699
BstC8I GCNNGC 1 cut(s) 55
BstDEI CTNAG 4 cut(s) 67, 558, 798, 995
BstF5I GGATG 1 cut(s) 14
BstKTI GATC 4 cut(s) 697, 778, 881, 937
BstMAI GTCTC 2 cut(s) 455, 993
BstMBI GATC 4 cut(s) 694, 775, 878, 934
BstMWI GCNNNNNNNGC 7 cut(s) 117, 134, 489, 601, 763, 902, 990
BstNI CCWGG 2 cut(s) 228, 494
BstNSI RCATGY 1 cut(s) 866
BstPAI GACNNNNGTC 1 cut(s) 1005
BstSCI CCNGG 2 cut(s) 226, 492
BstSFI CTRYAG 2 cut(s) 779, 887
BstV1I GCAGC 4 cut(s) 37, 601, 775, 853
BstV2I GAAGAC 1 cut(s) 185
BstX2I RGATCY 1 cut(s) 878
BstYI RGATCY 1 cut(s) 878
BsuRI GGCC 6 cut(s) 137, 296, 483, 640, 984, 993
BtsCI GGATG 1 cut(s) 14
BtsIMutI CAGTG 2 cut(s) 57, 78
Cac8I GCNNGC 1 cut(s) 55
Cfr13I GGNCC 1 cut(s) 481
CseI GACGC 3 cut(s) 84, 755, 844
CviAII CATG 4 cut(s) 311, 773, 832, 863
DdeI CTNAG 4 cut(s) 67, 558, 798, 995
DpnI GATC 4 cut(s) 696, 777, 880, 936
DpnII GATC 4 cut(s) 694, 775, 878, 934
EaeI YGGCCR 2 cut(s) 294, 638
Eam1104I CTCTTC 2 cut(s) 351, 699
EarI CTCTTC 2 cut(s) 351, 699
Eco130I CCWWGG 1 cut(s) 514
Eco147I AGGCCT 1 cut(s) 993
Eco57I CTGAAG 1 cut(s) 684
Eco88I CYCGRG 1 cut(s) 897
EcoRII CCWGG 2 cut(s) 226, 492
EcoT14I CCWWGG 1 cut(s) 514
ErhI CCWWGG 1 cut(s) 514
FaeI CATG 4 cut(s) 314, 776, 835, 866
FatI CATG 4 cut(s) 310, 772, 831, 862
FauNDI CATATG 1 cut(s) 1004
FbaI TGATCA 1 cut(s) 694
FblI GTMKAC 1 cut(s) 365
Fnu4HI GCNGC 6 cut(s) 51, 590, 593, 638, 764, 867
FokI GGATG 1 cut(s) 21
Fsp4HI GCNGC 6 cut(s) 51, 590, 593, 638, 764, 867
FspBI CTAG 2 cut(s) 150, 336
GluI GCNGC 6 cut(s) 51, 590, 593, 638, 764, 867
GsuI CTGGAG 1 cut(s) 515
HaeIII GGCC 6 cut(s) 137, 296, 483, 640, 984, 993
HgaI GACGC 3 cut(s) 84, 755, 844
Hin1II CATG 4 cut(s) 314, 776, 835, 866
HincII GTYRAC 1 cut(s) 770
HindII GTYRAC 1 cut(s) 770
HinfI GANTC 2 cut(s) 306, 362
Hpy166II GTNNAC 3 cut(s) 366, 610, 770
Hpy188I TCNGA 5 cut(s) 256, 730, 883, 919, 998
Hpy188III TCNNGA 3 cut(s) 160, 190, 692
Hpy8I GTNNAC 3 cut(s) 366, 610, 770
Hpy99I CGWCG 2 cut(s) 302, 971
HpyAV CCTTC 2 cut(s) 139, 499
HpyCH4III ACNGT 1 cut(s) 61
HpyCH4V TGCA 5 cut(s) 98, 285, 589, 763, 869
HpyF10VI GCNNNNNNNGC 7 cut(s) 117, 134, 489, 601, 763, 902, 990
HpyF3I CTNAG 4 cut(s) 67, 558, 798, 995
Hsp92II CATG 4 cut(s) 314, 776, 835, 866
Ksp22I TGATCA 1 cut(s) 694
Kzo9I GATC 4 cut(s) 694, 775, 878, 934
LmnI GCTCC 1 cut(s) 496
LpnPI CCDG 7 cut(s) 13, 66, 87, 213, 240, 479, 506
Lsp1109I GCAGC 4 cut(s) 37, 601, 775, 853
LweI GCATC 2 cut(s) 750, 792
MaeI CTAG 2 cut(s) 150, 336
MaeIII GTNAC 2 cut(s) 157, 616
MalI GATC 4 cut(s) 696, 777, 880, 936
MboI GATC 4 cut(s) 694, 775, 878, 934
MboII GAAGA 6 cut(s) 190, 368, 461, 482, 682, 716
MflI RGATCY 1 cut(s) 878
MluCI AATT 7 cut(s) 173, 207, 241, 273, 290, 404, 792
MlyI GAGTC 1 cut(s) 371
MmeI TCCRAC 2 cut(s) 52, 426
MnlI CCTC 6 cut(s) 352, 428, 567, 895, 974, 1004
MseI TTAA 6 cut(s) 210, 288, 786, 812, 875, 1018
MspA1I CMGCKG 1 cut(s) 592
MspR9I CCNGG 2 cut(s) 228, 494
Mva1269I GAATGC 1 cut(s) 111
MvaI CCWGG 2 cut(s) 228, 494
MwoI GCNNNNNNNGC 7 cut(s) 117, 134, 489, 601, 763, 902, 990
NdeI CATATG 1 cut(s) 1004
NdeII GATC 4 cut(s) 694, 775, 878, 934
NlaIII CATG 4 cut(s) 314, 776, 835, 866
NlaIV GGNNCC 1 cut(s) 498
NmuCI GTSAC 1 cut(s) 157
NspI RCATGY 1 cut(s) 866
PceI AGGCCT 1 cut(s) 993
PcsI WCGNNNNNNNCGW 1 cut(s) 972
PctI GAATGC 1 cut(s) 111
PfeI GAWTC 1 cut(s) 306
PkrI GCNGC 6 cut(s) 52, 591, 594, 639, 765, 868
PleI GAGTC 1 cut(s) 370
PpsI GAGTC 1 cut(s) 370
PshAI GACNNNNGTC 1 cut(s) 1005
PshBI ATTAAT 1 cut(s) 210
Psp6I CCWGG 2 cut(s) 226, 492
PspGI CCWGG 2 cut(s) 226, 492
PspN4I GGNNCC 1 cut(s) 498
PspPI GGNCC 1 cut(s) 481
PsrI GAACNNNNNNTAC 2 cut(s) 331, 363
PsuI RGATCY 1 cut(s) 878
SaqAI TTAA 6 cut(s) 210, 288, 786, 812, 875, 1018
SatI GCNGC 6 cut(s) 51, 590, 593, 638, 764, 867
Sau3AI GATC 4 cut(s) 694, 775, 878, 934
Sau96I GGNCC 1 cut(s) 481
SchI GAGTC 1 cut(s) 371
ScrFI CCNGG 2 cut(s) 228, 494
SetI ASST 4 cut(s) 149, 380, 786, 917
SfaNI GCATC 2 cut(s) 750, 792
SfcI CTRYAG 2 cut(s) 779, 887
SfiI GGCCNNNNNGGCC 1 cut(s) 990
SmlI CTYRAG 2 cut(s) 190, 806
SmoI CTYRAG 2 cut(s) 190, 806
Sse9I AATT 7 cut(s) 173, 207, 241, 273, 290, 404, 792
SseBI AGGCCT 1 cut(s) 993
SsiI CCGC 3 cut(s) 592, 637, 952
SspMI CTAG 2 cut(s) 150, 336
StuI AGGCCT 1 cut(s) 993
StyD4I CCNGG 2 cut(s) 226, 492
StyI CCWWGG 1 cut(s) 514
TaaI ACNGT 1 cut(s) 61
TaqI TCGA 2 cut(s) 14, 579
TasI AATT 7 cut(s) 173, 207, 241, 273, 290, 404, 792
TauI GCSGC 2 cut(s) 595, 640
TfiI GAWTC 1 cut(s) 306
Tru1I TTAA 6 cut(s) 210, 288, 786, 812, 875, 1018
Tru9I TTAA 6 cut(s) 210, 288, 786, 812, 875, 1018
TscAI CASTG 2 cut(s) 64, 85
TseFI GTSAC 1 cut(s) 157
TseI GCWGC 4 cut(s) 50, 589, 763, 866
Tsp45I GTSAC 1 cut(s) 157
TspDTI ATGAA 2 cut(s) 698, 873
TspGWI ACGGA 3 cut(s) 27, 362, 984
TspRI CASTG 2 cut(s) 64, 85
VspI ATTAAT 1 cut(s) 210
XapI RAATTY 1 cut(s) 404
XceI RCATGY 1 cut(s) 866
XmiI GTMKAC 1 cut(s) 365
XspI CTAG 2 cut(s) 150, 336
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.