Rmu_co8150926.1_g000001

Jacalin-like lectin domain

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8150926.1
Physical Location & Seq
Reverse (-)
2 .. 495
494 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8150926.1_g000001.1.cds

Sequence Viewer

Length: 417 bp
atgtgggatgacggagtttactcaacggtaaggcaattagtgatagctcatggctctgggattgactccatccagattgagtatgatagcaaagggtgctcattttggtcagacaagcatggtggaaatggaggctggaaaacagacaaggtgaagcttgattatccagaggaatttttgacttcaattcatgggtattatggcaagataagtgaatgggggacagtatcagtccgatcgcttactttcaagagcaacaaaagatcttatggaccttttggaattgaacaaggaaactatttttcacttccagtgacaactggtaacaaaattgttgggtttcatgggaggtctggctggtatcttgatgcaataggagcttacctcaagccgattcagaatgatcaaaaccactac
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

139

Amino Acids

15.63

Weight (kDa)

6.96

Isoelectric Point (pI)

35.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000621)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 173
AgsI TTSAA 3 cut(s) 186, 250, 287
AluBI AGCT 3 cut(s) 47, 157, 380
AluI AGCT 3 cut(s) 47, 157, 380
Alw21I GWGCWC 1 cut(s) 101
ApoI RAATTY 1 cut(s) 173
AspS9I GGNCC 1 cut(s) 272
AsuHPI GGTGA 1 cut(s) 163
AvaII GGWCC 1 cut(s) 272
Bbv12I GWGCWC 1 cut(s) 101
BccI CCATC 1 cut(s) 77
BclI TGATCA 1 cut(s) 403
BglII AGATCT 1 cut(s) 263
Bme18I GGWCC 1 cut(s) 272
BmgT120I GGNCC 1 cut(s) 272
BmsI GCATC 1 cut(s) 358
BplI GAGNNNNNCTC 2 cut(s) 369, 401
BpuEI CTTGAG 1 cut(s) 371
Bse1I ACTGG 2 cut(s) 311, 325
BseGI GGATG 2 cut(s) 13, 69
BseNI ACTGG 2 cut(s) 311, 325
Bsh1285I CGRYCG 1 cut(s) 239
BsiEI CGRYCG 1 cut(s) 239
BsiHKAI GWGCWC 1 cut(s) 101
BslFI GGGAC 1 cut(s) 235
BsmFI GGGAC 1 cut(s) 235
Bsp1286I GDGCHC 1 cut(s) 101
Bsp143I GATC 3 cut(s) 236, 263, 403
BsrI ACTGG 2 cut(s) 311, 325
BssMI GATC 3 cut(s) 236, 263, 403
Bst4CI ACNGT 2 cut(s) 28, 226
BstAPI GCANNNNNTGC 1 cut(s) 96
BstF5I GGATG 2 cut(s) 13, 69
BstKTI GATC 3 cut(s) 239, 266, 406
BstMBI GATC 3 cut(s) 236, 263, 403
BstMCI CGRYCG 1 cut(s) 239
BstMWI GCNNNNNNNGC 2 cut(s) 96, 377
BstX2I RGATCY 1 cut(s) 263
BstYI RGATCY 1 cut(s) 263
BtsCI GGATG 2 cut(s) 13, 69
BtsIMutI CAGTG 1 cut(s) 318
Cfr13I GGNCC 1 cut(s) 272
CspCI CAANNNNNGTGG 2 cut(s) 103, 138
CviAII CATG 4 cut(s) 50, 119, 191, 344
CviJI RGCY 7 cut(s) 47, 54, 135, 157, 357, 380, 391
CviKI_1 RGCY 7 cut(s) 47, 54, 135, 157, 357, 380, 391
DpnI GATC 3 cut(s) 238, 265, 405
DpnII GATC 3 cut(s) 236, 263, 403
Eco47I GGWCC 1 cut(s) 272
FaeI CATG 4 cut(s) 53, 122, 194, 347
FaiI YATR 7 cut(s) 51, 84, 120, 192, 201, 270, 345
FaqI GGGAC 1 cut(s) 235
FatI CATG 4 cut(s) 49, 118, 190, 343
FbaI TGATCA 1 cut(s) 403
FokI GGATG 2 cut(s) 20, 56
Hin1II CATG 4 cut(s) 53, 122, 194, 347
HindIII AAGCTT 1 cut(s) 155
HinfI GANTC 2 cut(s) 65, 394
HphI GGTGA 1 cut(s) 163
Hpy166II GTNNAC 1 cut(s) 19
Hpy188I TCNGA 3 cut(s) 112, 236, 399
Hpy188III TCNNGA 4 cut(s) 73, 167, 250, 365
Hpy8I GTNNAC 1 cut(s) 19
HpyCH4III ACNGT 2 cut(s) 28, 226
HpyCH4V TGCA 1 cut(s) 371
HpyF10VI GCNNNNNNNGC 2 cut(s) 96, 377
Hsp92II CATG 4 cut(s) 53, 122, 194, 347
Ksp22I TGATCA 1 cut(s) 403
Kzo9I GATC 3 cut(s) 236, 263, 403
LmnI GCTCC 1 cut(s) 377
LpnPI CCDG 8 cut(s) 42, 86, 121, 180, 306, 324, 339, 343
LweI GCATC 1 cut(s) 358
MaeIII GTNAC 2 cut(s) 313, 323
MalI GATC 3 cut(s) 238, 265, 405
MboI GATC 3 cut(s) 236, 263, 403
MflI RGATCY 1 cut(s) 263
MhlI GDGCHC 1 cut(s) 101
MluCI AATT 5 cut(s) 35, 173, 186, 282, 330
MlyI GAGTC 1 cut(s) 59
MnlI CCTC 4 cut(s) 125, 163, 342, 395
MwoI GCNNNNNNNGC 2 cut(s) 96, 377
NdeII GATC 3 cut(s) 236, 263, 403
NlaIII CATG 4 cut(s) 53, 122, 194, 347
NmuCI GTSAC 1 cut(s) 313
PfeI GAWTC 1 cut(s) 394
Ple19I CGATCG 1 cut(s) 239
PleI GAGTC 1 cut(s) 59
PpsI GAGTC 1 cut(s) 59
PspPI GGNCC 1 cut(s) 272
PsuI RGATCY 1 cut(s) 263
PvuI CGATCG 1 cut(s) 239
Sau3AI GATC 3 cut(s) 236, 263, 403
Sau96I GGNCC 1 cut(s) 272
SchI GAGTC 1 cut(s) 59
SduI GDGCHC 1 cut(s) 101
SetI ASST 7 cut(s) 49, 153, 159, 277, 353, 382, 387
SfaNI GCATC 1 cut(s) 358
SinI GGWCC 1 cut(s) 272
SmlI CTYRAG 1 cut(s) 386
SmoI CTYRAG 1 cut(s) 386
Sse9I AATT 5 cut(s) 35, 173, 186, 282, 330
TaaI ACNGT 2 cut(s) 28, 226
TasI AATT 5 cut(s) 35, 173, 186, 282, 330
TfiI GAWTC 1 cut(s) 394
TscAI CASTG 1 cut(s) 318
TseFI GTSAC 1 cut(s) 313
Tsp45I GTSAC 1 cut(s) 313
TspDTI ATGAA 2 cut(s) 179, 332
TspGWI ACGGA 1 cut(s) 27
TspRI CASTG 1 cut(s) 318
VpaK11BI GGWCC 1 cut(s) 272
XapI RAATTY 1 cut(s) 173
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.