Rmu_sc0000384.1_g000011

Glycosyl hydrolases family 28

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000384.1
OG0000579
Physical Location & Seq
Forward (+)
43891 .. 45926
2036 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000384.1_g000011.1.cds

Sequence Viewer

Length: 984 bp
atgcagtacatacttgtgagctttttgatattttgcatatcttcatctcatttaagcgacattgtatatggaaaaaaaacatatgatgttcttagttatggtgctgttggagatggaaacgctgatgattcaaaagcttttgtaagagcgtgggaagatttatgtggagcatctgaaacttatgatgtaccaacacttcagataccggcggggaaaacattcttattgcagcctacgaaatttaaaggtccatgcaaatcaaaaagtgttcatgttcaggtgttggggaaggtggtggcacccaaaacaccggatgcttggaaacagtgtgaatcaaattactggctttccttttcaaatgtggcaaacctcagaatgaatggcggttcaggaataatcgacggccagggttcatcttggtggagcaacgctaacgaacaaaagctccacatagatgacaagaagaagtgtcaacgaccaaaggctctacacttccatggatgtcataatcttctactaactggacttactcatgtaaatagtccgaaaggtcatattagtataagcaactgcagctatgtatatgtcgccaatctcactataactgcacctgaagagagtccaaacaccgatggaattgacatctcaaactcaaatcatgtcaacattcatgcctcttatattggaaccggtgatgattgtatagctatcaattctggatgttctaatatcaacattaccaacattgcatgtggcccaggccatggaattaggaatatccaaggtacttcagcaaaaaaggaggcgataagattagactgcaatcagttttcgggttgtcgcaacattgtaatggagaacatcaacatcacctcgaatggtcctggtaataaggggatacaggcatcatgctacaacatcaatggaatttctaaaagcacagtgccgagagtactttgcctgcagtccaaactggtccagtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00040 ko01100 map00040 map01100
Pfam Domains
Protein Families
Glyco_hydro_28

Protein Analysis

327

Amino Acids

35.35

Weight (kDa)

8.46

Isoelectric Point (pI)

39.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000579)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G32370 AT4G32375 AT4G32380 AT4G32380
fragaria_vesca FvH4_2g29242 FvH4_2g29270 FvH4_4g07180 FvH4_4g07190 FvH4_6g32320 FvH4_6g35100
malus_domestica MD03G1260700.v1.1 MD03G1260800.v1.1 MD09G1203400.v1.1 MD15G1065500.v1.1 MD15G1124200.v1.1 MD15G1124300.v1.1
prunus_persica Prupe.1G247300_v2.0.a1 Prupe.1G247300_v2.0.a1 Prupe.1G479600_v2.0.a1 Prupe.1G479700_v2.0.a1 Prupe.3G043600_v2.0.a1 Prupe.4G130600_v2.0.a1 Prupe.7G064200_v2.0.a1
pyrus_communis pycom03g20830 pycom15g06200
rosa_chinensis RchiOBHm_Chr2g0140421 RchiOBHm_Chr2g0146281 RchiOBHm_Chr3g0458021 RchiOBHm_Chr3g0481551 RchiOBHm_Chr4g0399361 RchiOBHm_Chr4g0399381 RchiOBHm_Chr4g0399391 RchiOBHm_Chr4g0399401 RchiOBHm_Chr4g0399411 RchiOBHm_Chr4g0399471
rosa_laevigata RLG00000009265 RLG00000009272 RLG00000011536 RLG00000011537 RLG00000019863 RLG00000020193 RLG00000023386
rosa_multiflora Rmu_sc0000384.1_g000011 Rmu_sc0002800.1_g000011 Rmu_sc0002800.1_g000012 Rmu_sc0017309.1_g000001 Rmu_sc0022824.1_g000003
rosa_roxburghii Rroxscaffold_153G00436780 Rroxscaffold_2G00100180 Rroxscaffold_5G00344320 Rroxscaffold_5G00344370 Rroxscaffold_6G00400330 Rroxscaffold_6G00421350 Rroxscaffold_7G00169940 Rroxscaffold_7G00169950
rosa_rugosa Rorug02G0362600 Rorug02G0394100 Rorug03G0024300 Rorug03G0192500 Rorug04G0016900 Rorug04G0017100 Rorug06G0278700
rosa_samantha Rh2CG399600 Rh2CG437200 Rh3AG084800 Rh3BG087600 Rh3CG088100 Rh3DG088500 Rh3DG270800 Rh4BG091900 Rh4BG092300 Rh5AG287300 Rh6DG389600
rosa_wichuraiana Rw0G012400 Rw2G033880 Rw2G036760 Rw3G007220 Rw3G021790 Rw4G007750 Rw4G007770 Rw4G007810

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 298
AccB7I CCANNNNNTGG 1 cut(s) 764
AciI CCGC 2 cut(s) 209, 384
AcoI YGGCCR 1 cut(s) 403
AcsI RAATTY 2 cut(s) 239, 927
AcuI CTGAAG 3 cut(s) 182, 633, 774
AfaI GTAC 4 cut(s) 8, 189, 787, 954
AfiI CCNNNNNNNGG 1 cut(s) 764
AgeI ACCGGT 1 cut(s) 689
AgsI TTSAA 2 cut(s) 132, 357
AjnI CCWGG 3 cut(s) 405, 757, 883
AloI GAACNNNNNNTCC 2 cut(s) 429, 461
AluBI AGCT 5 cut(s) 21, 137, 445, 576, 707
AluI AGCT 5 cut(s) 21, 137, 445, 576, 707
AoxI GGCC 3 cut(s) 403, 754, 760
ApeKI GCWGC 2 cut(s) 229, 573
ApoI RAATTY 2 cut(s) 239, 927
AsiGI ACCGGT 1 cut(s) 689
Asp700I GAANNNNTTC 1 cut(s) 218
AspS9I GGNCC 4 cut(s) 248, 755, 881, 976
AsuHPI GGTGA 2 cut(s) 704, 862
AvaII GGWCC 3 cut(s) 248, 881, 976
BanI GGYRCC 1 cut(s) 298
BarI GAAGNNNNNNTAC 2 cut(s) 180, 212
BbvI GCAGC 2 cut(s) 241, 585
BccI CCATC 2 cut(s) 107, 626
BceAI ACGGC 1 cut(s) 418
BciT130I CCWGG 3 cut(s) 407, 759, 885
BciVI GTATCC 1 cut(s) 891
BfmI CTRYAG 2 cut(s) 571, 962
BfuI GTATCC 1 cut(s) 891
BisI GCNGC 2 cut(s) 230, 574
BlsI GCNGC 2 cut(s) 231, 575
BmcAI AGTACT 1 cut(s) 954
Bme1390I CCNGG 3 cut(s) 407, 759, 885
Bme18I GGWCC 3 cut(s) 248, 881, 976
BmgT120I GGNCC 4 cut(s) 248, 755, 881, 976
BmiI GGNNCC 2 cut(s) 300, 688
BmrFI CCNGG 3 cut(s) 407, 759, 885
BmsI GCATC 3 cut(s) 179, 304, 914
BsaJI CCNNGG 5 cut(s) 406, 496, 757, 763, 781
BsaWI WCCGGW 2 cut(s) 310, 689
BsaXI ACNNNNNCTCC 2 cut(s) 429, 459
Bsc4I CCNNNNNNNGG 1 cut(s) 764
Bse118I RCCGGY 2 cut(s) 205, 689
Bse1I ACTGG 4 cut(s) 347, 526, 978, 979
Bse3DI GCAATG 1 cut(s) 744
BseBI CCWGG 3 cut(s) 407, 759, 885
BseDI CCNNGG 5 cut(s) 406, 496, 757, 763, 781
BseGI GGATG 3 cut(s) 319, 506, 725
BseLI CCNNNNNNNGG 1 cut(s) 764
BseMI GCAATG 1 cut(s) 744
BseMII CTCAG 1 cut(s) 385
BseNI ACTGG 4 cut(s) 347, 526, 978, 979
BseXI GCAGC 2 cut(s) 241, 585
BsgI GTGCAG 1 cut(s) 591
BshFI GGCC 3 cut(s) 405, 756, 762
BshNI GGYRCC 1 cut(s) 298
BshTI ACCGGT 1 cut(s) 689
BsiSI CCGG 3 cut(s) 206, 311, 690
BslI CCNNNNNNNGG 1 cut(s) 764
BsnI GGCC 3 cut(s) 405, 756, 762
Bsp19I CCATGG 2 cut(s) 496, 763
BspACI CCGC 2 cut(s) 209, 384
BspANI GGCC 3 cut(s) 405, 756, 762
BspCNI CTCAG 1 cut(s) 384
BspLI GGNNCC 2 cut(s) 300, 688
BspMAI CTGCAG 2 cut(s) 575, 966
BspT107I GGYRCC 1 cut(s) 298
BsrDI GCAATG 1 cut(s) 744
BsrFI RCCGGY 2 cut(s) 205, 689
BsrI ACTGG 4 cut(s) 347, 526, 978, 979
BssAI RCCGGY 2 cut(s) 205, 689
BssECI CCNNGG 5 cut(s) 406, 496, 757, 763, 781
BssT1I CCWWGG 3 cut(s) 496, 763, 781
Bst2UI CCWGG 3 cut(s) 407, 759, 885
Bst4CI ACNGT 2 cut(s) 327, 943
Bst6I CTCTTC 1 cut(s) 609
BstC8I GCNNGC 1 cut(s) 962
BstDEI CTNAG 2 cut(s) 92, 371
BstDSI CCRYGG 2 cut(s) 496, 763
BstF5I GGATG 3 cut(s) 319, 506, 725
BstMWI GCNNNNNNNGC 1 cut(s) 573
BstNI CCWGG 3 cut(s) 407, 759, 885
BstNSI RCATGY 1 cut(s) 753
BstSCI CCNGG 3 cut(s) 405, 757, 883
BstSFI CTRYAG 2 cut(s) 571, 962
BstV1I GCAGC 2 cut(s) 241, 585
BsuI GTATCC 1 cut(s) 891
BsuRI GGCC 3 cut(s) 405, 756, 762
BtgI CCRYGG 2 cut(s) 496, 763
BtsCI GGATG 3 cut(s) 319, 506, 725
BtsIMutI CAGTG 2 cut(s) 332, 948
Cac8I GCNNGC 1 cut(s) 962
Cfr10I RCCGGY 2 cut(s) 205, 689
Cfr13I GGNCC 4 cut(s) 248, 755, 881, 976
Csp6I GTAC 4 cut(s) 7, 188, 786, 953
CspAI ACCGGT 1 cut(s) 689
CviAII CATG 9 cut(s) 252, 272, 497, 533, 659, 671, 750, 764, 909
CviQI GTAC 4 cut(s) 7, 188, 786, 953
DdeI CTNAG 2 cut(s) 92, 371
DraI TTTAAA 1 cut(s) 244
EaeI YGGCCR 1 cut(s) 403
Eam1104I CTCTTC 1 cut(s) 609
EarI CTCTTC 1 cut(s) 609
Eco130I CCWWGG 3 cut(s) 496, 763, 781
Eco47I GGWCC 3 cut(s) 248, 881, 976
Eco57I CTGAAG 3 cut(s) 182, 633, 774
EcoRII CCWGG 3 cut(s) 405, 757, 883
EcoT14I CCWWGG 3 cut(s) 496, 763, 781
ErhI CCWWGG 3 cut(s) 496, 763, 781
FaeI CATG 9 cut(s) 255, 275, 500, 536, 662, 674, 753, 767, 912
FatI CATG 9 cut(s) 251, 271, 496, 532, 658, 670, 749, 763, 908
FauI CCCGC 1 cut(s) 202
FauNDI CATATG 1 cut(s) 82
Fnu4HI GCNGC 2 cut(s) 230, 574
FokI GGATG 3 cut(s) 326, 513, 732
Fsp4HI GCNGC 2 cut(s) 230, 574
GluI GCNGC 2 cut(s) 230, 574
HaeIII GGCC 3 cut(s) 405, 756, 762
HapII CCGG 3 cut(s) 206, 311, 690
Hin1II CATG 9 cut(s) 255, 275, 500, 536, 662, 674, 753, 767, 912
HincII GTYRAC 2 cut(s) 473, 664
HindII GTYRAC 2 cut(s) 473, 664
HindIII AAGCTT 1 cut(s) 135
HinfI GANTC 3 cut(s) 128, 332, 619
HpaII CCGG 3 cut(s) 206, 311, 690
HphI GGTGA 2 cut(s) 704, 862
Hpy166II GTNNAC 2 cut(s) 473, 664
Hpy188I TCNGA 4 cut(s) 175, 201, 374, 546
Hpy188III TCNNGA 2 cut(s) 390, 717
Hpy8I GTNNAC 2 cut(s) 473, 664
Hpy99I CGWCG 1 cut(s) 404
HpyAV CCTTC 1 cut(s) 283
HpyCH4III ACNGT 2 cut(s) 327, 943
HpyCH4V TGCA 9 cut(s) 4, 36, 229, 255, 573, 608, 749, 822, 964
HpyF10VI GCNNNNNNNGC 1 cut(s) 573
HpyF3I CTNAG 2 cut(s) 92, 371
Hsp92II CATG 9 cut(s) 255, 275, 500, 536, 662, 674, 753, 767, 912
LmnI GCTCC 3 cut(s) 167, 423, 450
Lsp1109I GCAGC 2 cut(s) 241, 585
LweI GCATC 3 cut(s) 179, 304, 914
MboII GAAGA 5 cut(s) 33, 167, 475, 503, 626
MluCI AATT 6 cut(s) 239, 337, 636, 712, 768, 927
MlyI GAGTC 1 cut(s) 628
MmeI TCCRAC 1 cut(s) 88
MnlI CCTC 4 cut(s) 380, 685, 796, 883
MroXI GAANNNNTTC 1 cut(s) 218
MseI TTAA 2 cut(s) 53, 243
MslI CAYNNNNRTG 5 cut(s) 14, 418, 453, 495, 851
MspI CCGG 3 cut(s) 206, 311, 690
MspR9I CCNGG 3 cut(s) 407, 759, 885
MvaI CCWGG 3 cut(s) 407, 759, 885
MwoI GCNNNNNNNGC 1 cut(s) 573
NcoI CCATGG 2 cut(s) 496, 763
NdeI CATATG 1 cut(s) 82
NlaIII CATG 9 cut(s) 255, 275, 500, 536, 662, 674, 753, 767, 912
NlaIV GGNNCC 2 cut(s) 300, 688
NmeAIII GCCGAG 1 cut(s) 972
NspI RCATGY 1 cut(s) 753
PdmI GAANNNNTTC 1 cut(s) 218
PfeI GAWTC 2 cut(s) 128, 332
PflMI CCANNNNNTGG 1 cut(s) 764
PinAI ACCGGT 1 cut(s) 689
PkrI GCNGC 2 cut(s) 231, 575
PleI GAGTC 1 cut(s) 627
PpsI GAGTC 1 cut(s) 627
Psp6I CCWGG 3 cut(s) 405, 757, 883
PspGI CCWGG 3 cut(s) 405, 757, 883
PspN4I GGNNCC 2 cut(s) 300, 688
PspPI GGNCC 4 cut(s) 248, 755, 881, 976
PstI CTGCAG 2 cut(s) 575, 966
RsaI GTAC 4 cut(s) 8, 189, 787, 954
RsaNI GTAC 4 cut(s) 7, 188, 786, 953
RseI CAYNNNNRTG 5 cut(s) 14, 418, 453, 495, 851
SaqAI TTAA 2 cut(s) 53, 243
SatI GCNGC 2 cut(s) 230, 574
Sau96I GGNCC 4 cut(s) 248, 755, 881, 976
ScaI AGTACT 1 cut(s) 954
SchI GAGTC 1 cut(s) 628
ScrFI CCNGG 3 cut(s) 407, 759, 885
SfaNI GCATC 3 cut(s) 179, 304, 914
SfcI CTRYAG 2 cut(s) 571, 962
SinI GGWCC 3 cut(s) 248, 881, 976
SmiMI CAYNNNNRTG 5 cut(s) 14, 418, 453, 495, 851
Sse9I AATT 6 cut(s) 239, 337, 636, 712, 768, 927
SsiI CCGC 2 cut(s) 209, 384
StyD4I CCNGG 3 cut(s) 405, 757, 883
StyI CCWWGG 3 cut(s) 496, 763, 781
TaaI ACNGT 2 cut(s) 327, 943
TaqI TCGA 2 cut(s) 399, 875
TasI AATT 6 cut(s) 239, 337, 636, 712, 768, 927
TatI WGTACW 2 cut(s) 6, 952
TfiI GAWTC 2 cut(s) 128, 332
Tru1I TTAA 2 cut(s) 53, 243
Tru9I TTAA 2 cut(s) 53, 243
TscAI CASTG 2 cut(s) 332, 948
TseI GCWGC 2 cut(s) 229, 573
TspDTI ATGAA 5 cut(s) 33, 260, 392, 402, 659
TspRI CASTG 2 cut(s) 332, 948
Van91I CCANNNNNTGG 1 cut(s) 764
VpaK11BI GGWCC 3 cut(s) 248, 881, 976
XapI RAATTY 2 cut(s) 239, 927
XceI RCATGY 1 cut(s) 753
XmnI GAANNNNTTC 1 cut(s) 218
ZrmI AGTACT 1 cut(s) 954
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.