Rmu_sc0026716.1_g000001

Belongs to the cytochrome b5 family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0026716.1
Physical Location & Seq
Reverse (-)
616 .. 906
291 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0026716.1_g000001.1.cds

Sequence Viewer

Length: 291 bp
ctgtgcaactctgggaacacaactaaaggaggtgatcatggtctacccacgggcctatcttcggctaccttcttcacactcctggctctgttctttgctgcttaccatgtcttttctgggatttttgggtcgtctgatacccaccaccggcccaagaacttggaggagatgcagcctctgctgccgctggtccagctaggtgagatcaccgccgaggatctgaagcaatacgacggctctaatccaaacaagcctctgctcatggccatcaagtctcagatgtattggtga

Protein Analysis

96

Amino Acids

10.53

Weight (kDa)

6.03

Isoelectric Point (pI)

32.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 43
AciI CCGC 2 cut(s) 185, 210
AclWI GGATC 1 cut(s) 225
AcoI YGGCCR 1 cut(s) 264
AcuI CTGAAG 1 cut(s) 242
AfiI CCNNNNNNNGG 2 cut(s) 61, 147
AjnI CCWGG 1 cut(s) 81
AluBI AGCT 1 cut(s) 196
AluI AGCT 1 cut(s) 196
Alw26I GTCTC 1 cut(s) 279
AlwI GGATC 1 cut(s) 225
AlwNI CAGNNNCTG 1 cut(s) 178
AoxI GGCC 3 cut(s) 52, 149, 264
ApeKI GCWGC 3 cut(s) 98, 172, 181
AspS9I GGNCC 3 cut(s) 52, 150, 190
AsuHPI GGTGA 3 cut(s) 44, 199, 212
AvaII GGWCC 1 cut(s) 190
BalI TGGCCA 1 cut(s) 266
BbvI GCAGC 3 cut(s) 85, 168, 184
BccI CCATC 1 cut(s) 275
BceAI ACGGC 1 cut(s) 250
BciT130I CCWGG 1 cut(s) 83
BclI TGATCA 1 cut(s) 34
BcoDI GTCTC 1 cut(s) 279
BfaI CTAG 1 cut(s) 197
BisI GCNGC 4 cut(s) 99, 173, 182, 185
BlsI GCNGC 4 cut(s) 100, 174, 183, 186
Bme1390I CCNGG 1 cut(s) 83
Bme18I GGWCC 1 cut(s) 190
BmgT120I GGNCC 3 cut(s) 52, 150, 190
BmrFI CCNGG 1 cut(s) 83
BmsI GCATC 1 cut(s) 159
BsaJI CCNNGG 2 cut(s) 48, 213
Bsc4I CCNNNNNNNGG 2 cut(s) 61, 147
Bse118I RCCGGY 1 cut(s) 147
BseBI CCWGG 1 cut(s) 83
BseDI CCNNGG 2 cut(s) 48, 213
BseLI CCNNNNNNNGG 2 cut(s) 61, 147
BseMII CTCAG 1 cut(s) 290
BseRI GAGGAG 1 cut(s) 179
BseXI GCAGC 3 cut(s) 85, 168, 184
BshFI GGCC 3 cut(s) 54, 151, 266
BsiSI CCGG 1 cut(s) 148
BslI CCNNNNNNNGG 2 cut(s) 61, 147
BsmAI GTCTC 1 cut(s) 279
BsnI GGCC 3 cut(s) 54, 151, 266
Bsp143I GATC 3 cut(s) 34, 204, 217
BspACI CCGC 2 cut(s) 185, 210
BspANI GGCC 3 cut(s) 54, 151, 266
BspCNI CTCAG 1 cut(s) 289
BspPI GGATC 1 cut(s) 225
BsrFI RCCGGY 1 cut(s) 147
BssAI RCCGGY 1 cut(s) 147
BssECI CCNNGG 2 cut(s) 48, 213
BssMI GATC 3 cut(s) 34, 204, 217
Bst2UI CCWGG 1 cut(s) 83
BstAPI GCANNNNNTGC 1 cut(s) 178
BstDEI CTNAG 1 cut(s) 276
BstDSI CCRYGG 1 cut(s) 48
BstKTI GATC 3 cut(s) 37, 207, 220
BstMAI GTCTC 1 cut(s) 279
BstMBI GATC 3 cut(s) 34, 204, 217
BstMWI GCNNNNNNNGC 3 cut(s) 178, 181, 193
BstNI CCWGG 1 cut(s) 83
BstSCI CCNGG 1 cut(s) 81
BstV1I GCAGC 3 cut(s) 85, 168, 184
BstX2I RGATCY 1 cut(s) 217
BstXI CCANNNNNNTGG 1 cut(s) 160
BstYI RGATCY 1 cut(s) 217
BsuRI GGCC 3 cut(s) 54, 151, 266
BtgI CCRYGG 1 cut(s) 48
CaiI CAGNNNCTG 1 cut(s) 178
Cfr10I RCCGGY 1 cut(s) 147
Cfr13I GGNCC 3 cut(s) 52, 150, 190
CviAII CATG 3 cut(s) 38, 107, 262
CviJI RGCY 9 cut(s) 54, 65, 86, 151, 175, 196, 237, 253, 266
CviKI_1 RGCY 9 cut(s) 54, 65, 86, 151, 175, 196, 237, 253, 266
DdeI CTNAG 1 cut(s) 276
DpnI GATC 3 cut(s) 36, 206, 219
DpnII GATC 3 cut(s) 34, 204, 217
EaeI YGGCCR 1 cut(s) 264
Eco47I GGWCC 1 cut(s) 190
Eco57I CTGAAG 1 cut(s) 242
EcoRII CCWGG 1 cut(s) 81
FaeI CATG 3 cut(s) 41, 110, 265
FaiI YATR 3 cut(s) 39, 108, 263
FatI CATG 3 cut(s) 37, 106, 261
FbaI TGATCA 1 cut(s) 34
FblI GTMKAC 1 cut(s) 43
Fnu4HI GCNGC 4 cut(s) 99, 173, 182, 185
Fsp4HI GCNGC 4 cut(s) 99, 173, 182, 185
FspBI CTAG 1 cut(s) 197
GluI GCNGC 4 cut(s) 99, 173, 182, 185
HaeIII GGCC 3 cut(s) 54, 151, 266
HapII CCGG 1 cut(s) 148
Hin1II CATG 3 cut(s) 41, 110, 265
HpaII CCGG 1 cut(s) 148
HphI GGTGA 3 cut(s) 44, 199, 212
Hpy166II GTNNAC 1 cut(s) 44
Hpy188I TCNGA 3 cut(s) 136, 222, 279
Hpy8I GTNNAC 1 cut(s) 44
Hpy99I CGWCG 1 cut(s) 236
HpyAV CCTTC 1 cut(s) 79
HpyCH4V TGCA 2 cut(s) 6, 172
HpyF10VI GCNNNNNNNGC 3 cut(s) 178, 181, 193
HpyF3I CTNAG 1 cut(s) 276
Hsp92II CATG 3 cut(s) 41, 110, 265
Ksp22I TGATCA 1 cut(s) 34
Kzo9I GATC 3 cut(s) 34, 204, 217
LpnPI CCDG 6 cut(s) 68, 95, 102, 161, 173, 206
Lsp1109I GCAGC 3 cut(s) 85, 168, 184
LweI GCATC 1 cut(s) 159
MaeI CTAG 1 cut(s) 197
MalI GATC 3 cut(s) 36, 206, 219
MboI GATC 3 cut(s) 34, 204, 217
MboII GAAGA 2 cut(s) 51, 64
MflI RGATCY 1 cut(s) 217
MlsI TGGCCA 1 cut(s) 266
MluNI TGGCCA 1 cut(s) 266
MnlI CCTC 5 cut(s) 23, 157, 186, 208, 264
Mox20I TGGCCA 1 cut(s) 266
MscI TGGCCA 1 cut(s) 266
Msp20I TGGCCA 1 cut(s) 266
MspA1I CMGCKG 1 cut(s) 187
MspI CCGG 1 cut(s) 148
MspR9I CCNGG 1 cut(s) 83
MvaI CCWGG 1 cut(s) 83
MwoI GCNNNNNNNGC 3 cut(s) 178, 181, 193
NdeII GATC 3 cut(s) 34, 204, 217
NlaIII CATG 3 cut(s) 41, 110, 265
NmeAIII GCCGAG 1 cut(s) 238
PkrI GCNGC 4 cut(s) 100, 174, 183, 186
Psp6I CCWGG 1 cut(s) 81
PspGI CCWGG 1 cut(s) 81
PspPI GGNCC 3 cut(s) 52, 150, 190
PstNI CAGNNNCTG 1 cut(s) 178
PsuI RGATCY 1 cut(s) 217
SatI GCNGC 4 cut(s) 99, 173, 182, 185
Sau3AI GATC 3 cut(s) 34, 204, 217
Sau96I GGNCC 3 cut(s) 52, 150, 190
ScrFI CCNGG 1 cut(s) 83
SetI ASST 4 cut(s) 34, 71, 198, 202
SfaNI GCATC 1 cut(s) 159
SinI GGWCC 1 cut(s) 190
SsiI CCGC 2 cut(s) 185, 210
SspMI CTAG 1 cut(s) 197
StyD4I CCNGG 1 cut(s) 81
TauI GCSGC 1 cut(s) 187
TseI GCWGC 3 cut(s) 98, 172, 181
VpaK11BI GGWCC 1 cut(s) 190
XcmI CCANNNNNNNNNTGG 1 cut(s) 113
XmiI GTMKAC 1 cut(s) 43
XspI CTAG 1 cut(s) 197
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.