Rmu_ssc0000160.1_g000012

Belongs to the cytochrome b5 family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000160.1
Physical Location & Seq
Reverse (-)
65290 .. 65553
264 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000160.1_g000012.1.cds

Sequence Viewer

Length: 264 bp
atgaggcaatcgtggtctacacaggcctatctccgtgaccttcttcacactcctggctatgatctttgccacttaccatgtctcttttctgggatttttgggtcgtccaagacccatcaccgccccatgaacttggaggagatgcagcctctgctgctgcaggtccagctaggcgagatcaccaccgaggagctgaaacagtatgatggctctgatcccaacaagcctctgctcatggccatcaagtctctgatctattggtga

Protein Analysis

87

Amino Acids

10.08

Weight (kDa)

6.02

Isoelectric Point (pI)

48.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 151
AccI GTMKAC 1 cut(s) 17
AciI CCGC 1 cut(s) 121
AclWI GGATC 1 cut(s) 209
AcoI YGGCCR 1 cut(s) 237
AjnI CCWGG 1 cut(s) 52
AluBI AGCT 2 cut(s) 169, 193
AluI AGCT 2 cut(s) 169, 193
Alw26I GTCTC 2 cut(s) 86, 252
AlwI GGATC 1 cut(s) 209
AlwNI CAGNNNCTG 1 cut(s) 151
AoxI GGCC 2 cut(s) 24, 237
ApeKI GCWGC 3 cut(s) 145, 154, 157
AspS9I GGNCC 1 cut(s) 163
AsuHPI GGTGA 2 cut(s) 110, 172
AvaII GGWCC 1 cut(s) 163
BalI TGGCCA 1 cut(s) 239
BbvI GCAGC 3 cut(s) 141, 144, 157
BccI CCATC 3 cut(s) 123, 200, 248
BciT130I CCWGG 1 cut(s) 54
BcoDI GTCTC 2 cut(s) 86, 252
BfaI CTAG 1 cut(s) 170
BfmI CTRYAG 1 cut(s) 158
BfuAI ACCTGC 1 cut(s) 151
BisI GCNGC 3 cut(s) 146, 155, 158
BlsI GCNGC 3 cut(s) 147, 156, 159
Bme1390I CCNGG 1 cut(s) 54
Bme18I GGWCC 1 cut(s) 163
BmgT120I GGNCC 1 cut(s) 163
BmrFI CCNGG 1 cut(s) 54
BmsI GCATC 1 cut(s) 132
BsaJI CCNNGG 1 cut(s) 186
BseBI CCWGG 1 cut(s) 54
BseDI CCNNGG 1 cut(s) 186
BseRI GAGGAG 2 cut(s) 152, 203
BseXI GCAGC 3 cut(s) 141, 144, 157
BshFI GGCC 2 cut(s) 26, 239
BsmAI GTCTC 2 cut(s) 86, 252
BsnI GGCC 2 cut(s) 26, 239
Bsp143I GATC 4 cut(s) 61, 177, 214, 252
BspACI CCGC 1 cut(s) 121
BspANI GGCC 2 cut(s) 26, 239
BspMAI CTGCAG 1 cut(s) 162
BspMI ACCTGC 1 cut(s) 151
BspPI GGATC 1 cut(s) 209
BssECI CCNNGG 1 cut(s) 186
BssMI GATC 4 cut(s) 61, 177, 214, 252
Bst2UI CCWGG 1 cut(s) 54
Bst4CI ACNGT 1 cut(s) 201
BstAPI GCANNNNNTGC 1 cut(s) 151
BstKTI GATC 4 cut(s) 64, 180, 217, 255
BstMAI GTCTC 2 cut(s) 86, 252
BstMBI GATC 4 cut(s) 61, 177, 214, 252
BstMWI GCNNNNNNNGC 3 cut(s) 151, 154, 166
BstNI CCWGG 1 cut(s) 54
BstSCI CCNGG 1 cut(s) 52
BstSFI CTRYAG 1 cut(s) 158
BstV1I GCAGC 3 cut(s) 141, 144, 157
BstXI CCANNNNNNTGG 1 cut(s) 133
BsuRI GGCC 2 cut(s) 26, 239
BveI ACCTGC 1 cut(s) 151
CaiI CAGNNNCTG 1 cut(s) 151
Cfr13I GGNCC 1 cut(s) 163
CviAII CATG 3 cut(s) 78, 127, 235
CviJI RGCY 8 cut(s) 26, 57, 148, 169, 193, 210, 226, 239
CviKI_1 RGCY 8 cut(s) 26, 57, 148, 169, 193, 210, 226, 239
DpnI GATC 4 cut(s) 63, 179, 216, 254
DpnII GATC 4 cut(s) 61, 177, 214, 252
EaeI YGGCCR 1 cut(s) 237
Eco147I AGGCCT 1 cut(s) 26
Eco47I GGWCC 1 cut(s) 163
EcoRII CCWGG 1 cut(s) 52
FaeI CATG 3 cut(s) 81, 130, 238
FaiI YATR 5 cut(s) 60, 79, 128, 204, 236
FatI CATG 3 cut(s) 77, 126, 234
FblI GTMKAC 1 cut(s) 17
Fnu4HI GCNGC 3 cut(s) 146, 155, 158
Fsp4HI GCNGC 3 cut(s) 146, 155, 158
FspBI CTAG 1 cut(s) 170
GluI GCNGC 3 cut(s) 146, 155, 158
HaeIII GGCC 2 cut(s) 26, 239
Hin1II CATG 3 cut(s) 81, 130, 238
HphI GGTGA 2 cut(s) 110, 172
Hpy166II GTNNAC 1 cut(s) 18
Hpy188I TCNGA 2 cut(s) 214, 252
Hpy8I GTNNAC 1 cut(s) 18
HpyAV CCTTC 1 cut(s) 50
HpyCH4III ACNGT 1 cut(s) 201
HpyCH4V TGCA 2 cut(s) 145, 160
HpyF10VI GCNNNNNNNGC 3 cut(s) 151, 154, 166
Hsp92II CATG 3 cut(s) 81, 130, 238
Kzo9I GATC 4 cut(s) 61, 177, 214, 252
LmnI GCTCC 1 cut(s) 190
LpnPI CCDG 6 cut(s) 8, 39, 66, 75, 146, 179
Lsp1109I GCAGC 3 cut(s) 141, 144, 157
LweI GCATC 1 cut(s) 132
MaeI CTAG 1 cut(s) 170
MaeIII GTNAC 1 cut(s) 35
MalI GATC 4 cut(s) 63, 179, 216, 254
MboI GATC 4 cut(s) 61, 177, 214, 252
MboII GAAGA 1 cut(s) 35
MlsI TGGCCA 1 cut(s) 239
MluNI TGGCCA 1 cut(s) 239
MnlI CCTC 4 cut(s) 130, 159, 181, 237
Mox20I TGGCCA 1 cut(s) 239
MscI TGGCCA 1 cut(s) 239
Msp20I TGGCCA 1 cut(s) 239
MspR9I CCNGG 1 cut(s) 54
MvaI CCWGG 1 cut(s) 54
MwoI GCNNNNNNNGC 3 cut(s) 151, 154, 166
NdeII GATC 4 cut(s) 61, 177, 214, 252
NlaIII CATG 3 cut(s) 81, 130, 238
NmuCI GTSAC 1 cut(s) 35
PceI AGGCCT 1 cut(s) 26
PkrI GCNGC 3 cut(s) 147, 156, 159
Psp6I CCWGG 1 cut(s) 52
PspGI CCWGG 1 cut(s) 52
PspPI GGNCC 1 cut(s) 163
PstI CTGCAG 1 cut(s) 162
PstNI CAGNNNCTG 1 cut(s) 151
SatI GCNGC 3 cut(s) 146, 155, 158
Sau3AI GATC 4 cut(s) 61, 177, 214, 252
Sau96I GGNCC 1 cut(s) 163
ScrFI CCNGG 1 cut(s) 54
SetI ASST 4 cut(s) 42, 165, 171, 195
SfaNI GCATC 1 cut(s) 132
SfcI CTRYAG 1 cut(s) 158
SinI GGWCC 1 cut(s) 163
SseBI AGGCCT 1 cut(s) 26
SsiI CCGC 1 cut(s) 121
SspMI CTAG 1 cut(s) 170
StuI AGGCCT 1 cut(s) 26
StyD4I CCNGG 1 cut(s) 52
TaaI ACNGT 1 cut(s) 201
TseFI GTSAC 1 cut(s) 35
TseI GCWGC 3 cut(s) 145, 154, 157
Tsp45I GTSAC 1 cut(s) 35
TspDTI ATGAA 1 cut(s) 143
TspGWI ACGGA 1 cut(s) 23
VpaK11BI GGWCC 1 cut(s) 163
XmiI GTMKAC 1 cut(s) 17
XspI CTAG 1 cut(s) 170
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.