Rh4AG386700

MLP-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
OG0000504
Physical Location & Seq
Forward (+)
69312102 .. 69319240
7139 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG386700.1

Sequence Viewer

Length: 204 bp
ATGGAACTGTTGAGACATGAAGCAAATAAGAGAATGAGTCTCACAGCATTGGAGGCACATGTGCTGGAGCAATACAGAAGCTATAAGATTATCTTTCAGGTCACTCCAAAGAGTGATGAAGGAGGTAATCAGGTCAAAATTACTCTGGAATATGAAAAGCTCAATGAGAGTGACCAGCCTCCGCATAAGGAATATACTCATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Bet_v_1

Protein Analysis

67

Amino Acids

7.91

Weight (kDa)

6.04

Isoelectric Point (pI)

36.54

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Bet_v_1 PF00407 7 - 65 5.2e-13 Pathogenesis-related protein Bet v 1 family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000504)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G14930 AT1G14940 AT1G14940 AT1G14950 AT1G14960 AT1G30990 AT2G01520 AT2G01530 AT3G26450 AT3G26460 AT4G14060 AT4G23670 AT4G23680
fragaria_vesca FvH4_4g32700 FvH4_4g32700 FvH4_4g32700 FvH4_4g32720 FvH4_4g32731
malus_domestica MD13G1023200.v1.1 MD13G1023300.v1.1 MD16G1024100.v1.1 MD16G1024400.v1.1 MD16G1024700.v1.1 MD16G1024900.v1.1 MD16G1025300.v1.1 MD16G1025600.v1.1 MD16G1025800.v1.1 MD16G1026000.v1.1 MD16G1026200.v1.1
prunus_persica Prupe.1G327300_v2.0.a1 Prupe.1G327400_v2.0.a1 Prupe.1G327500_v2.0.a1 Prupe.1G327600_v2.0.a1 Prupe.1G327600_v2.0.a1 Prupe.1G327700_v2.0.a1 Prupe.1G328000_v2.0.a1 Prupe.1G328100_v2.0.a1 Prupe.1G328200_v2.0.a1 Prupe.1G328400_v2.0.a1
pyrus_communis pycom13g02140 pycom13g02160 pycom13g02170 pycom16g02120 pycom16g02130 pycom16g02170 pycom16g02180 pycom16g02200 pycom16g02210
rosa_chinensis RchiOBHm_Chr4g0441631 RchiOBHm_Chr4g0441641 RchiOBHm_Chr4g0441681 RchiOBHm_Chr4g0441721
rosa_laevigata RLG00000006072 RLG00000006074 RLG00000006075 RLG00000006077 RLG00000006078 RLG00000006079 RLG00000006080 RLG00000034069
rosa_multiflora Rmu_sc0000353.1_g000008 Rmu_sc0000353.1_g000014 Rmu_sc0000353.1_g000021 Rmu_ssc0000486.1_g000039
rosa_roxburghii Rroxscaffold_5G00382450 Rroxscaffold_5G00382460 Rroxscaffold_5G00382500 Rroxscaffold_5G00382510
rosa_rugosa Rorug04G0335100 Rorug04G0335300 Rorug04G0335400 Rorug04G0335500
rosa_samantha Rh4AG386500 Rh4AG386600 Rh4AG386700 Rh4AG386900 Rh4AG387100 Rh4BG400700 Rh4BG400800 Rh4CG415700 Rh4CG415800 Rh4DG393400 Rh4DG393500 Rh4DG393900 Rh4DG394200
rosa_wichuraiana Rw4G033390 Rw4G033430

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 182
AflIII ACRYGT 1 cut(s) 58
AluBI AGCT 2 cut(s) 81, 160
AluI AGCT 2 cut(s) 81, 160
Alw26I GTCTC 2 cut(s) 7, 44
BcoDI GTCTC 2 cut(s) 7, 44
BpmI CTGGAG 1 cut(s) 86
BsmAI GTCTC 2 cut(s) 7, 44
BspACI CCGC 1 cut(s) 182
Bst4CI ACNGT 1 cut(s) 9
BstMAI GTCTC 2 cut(s) 7, 44
BstMWI GCNNNNNNNGC 1 cut(s) 53
BstNSI RCATGY 1 cut(s) 62
CviAII CATG 2 cut(s) 17, 59
CviJI RGCY 3 cut(s) 81, 160, 178
CviKI_1 RGCY 3 cut(s) 81, 160, 178
FaeI CATG 2 cut(s) 20, 62
FaiI YATR 6 cut(s) 18, 60, 84, 153, 186, 195
FalI AAGNNNNNCTT 2 cut(s) 77, 109
FatI CATG 2 cut(s) 16, 58
GsuI CTGGAG 1 cut(s) 86
Hin1II CATG 2 cut(s) 20, 62
HinfI GANTC 1 cut(s) 37
Hpy188III TCNNGA 1 cut(s) 146
HpyAV CCTTC 1 cut(s) 113
HpyCH4III ACNGT 1 cut(s) 9
HpyF10VI GCNNNNNNNGC 1 cut(s) 53
Hsp92II CATG 2 cut(s) 20, 62
LmnI GCTCC 1 cut(s) 67
LpnPI CCDG 5 cut(s) 50, 83, 116, 131, 188
MaeIII GTNAC 2 cut(s) 100, 170
MluCI AATT 1 cut(s) 138
MlyI GAGTC 1 cut(s) 46
MnlI CCTC 3 cut(s) 46, 116, 189
MseI TTAA 1 cut(s) 202
MwoI GCNNNNNNNGC 1 cut(s) 53
NlaIII CATG 2 cut(s) 20, 62
NmuCI GTSAC 2 cut(s) 100, 170
NspI RCATGY 1 cut(s) 62
PciI ACATGT 1 cut(s) 58
PleI GAGTC 1 cut(s) 45
PpsI GAGTC 1 cut(s) 45
PscI ACATGT 1 cut(s) 58
SaqAI TTAA 1 cut(s) 202
SchI GAGTC 1 cut(s) 46
SetI ASST 5 cut(s) 83, 102, 127, 135, 162
SgeI CNNG 7 cut(s) 29, 71, 77, 110, 143, 158, 187
Sse9I AATT 1 cut(s) 138
SsiI CCGC 1 cut(s) 182
TaaI ACNGT 1 cut(s) 9
TasI AATT 1 cut(s) 138
Tru1I TTAA 1 cut(s) 202
Tru9I TTAA 1 cut(s) 202
TseFI GTSAC 2 cut(s) 100, 170
Tsp45I GTSAC 2 cut(s) 100, 170
TspDTI ATGAA 3 cut(s) 33, 132, 168
XceI RCATGY 1 cut(s) 62
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.