FvH4_4g03321

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb4
OG0001143
Physical Location & Seq
Reverse (-)
2953714 .. 2954392
679 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_4g03321.t1

Sequence Viewer

Length: 459 bp
ATGATGACTTCTTTCAAAGAGTTAGAAACTTCCAATGCTTGTATATTCATAACAGAGTTGATCAACGGTTTTCCTTTTCAAAATCTGATGGCTAAAGGGAGGAAATCGGTTGCTCAGCGAAATGAAGGTGCTTCCGCGCTTGCTGATTCTTCCACAGCAACATCACCTTCTGAGCCCCTTCTAATTGAAGACGTCGAAACTTCAAGCGAGGCAGGAAGTGAGCAAGCTCCTGGAACACAAGATATAGGACCAGAACAACCTCTTGAAACACAACAAGCTCCTTCAAACCAGCAAGCTCCTACAACAGAAGAAGGTTCTTCAAATCCAGGTGAGTCTTCTCTAGGGGATACAAAGGTTAAACGTAGTAAAGTTTGGAAGCACTTTAAGGAATATCAAAAGATTGTGAAGGGTAAAGATGATGAAGGGAACCCGATAGACATTGTGCAAGATAGAGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

153

Amino Acids

16.42

Weight (kDa)

4.64

Isoelectric Point (pI)

47.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 195
AccII CGCG 1 cut(s) 137
AciI CCGC 1 cut(s) 135
AcyI GRCGYC 1 cut(s) 192
AgsI TTSAA 7 cut(s) 16, 80, 188, 204, 266, 285, 321
AjnI CCWGG 2 cut(s) 229, 325
AluBI AGCT 4 cut(s) 227, 278, 296, 455
AluI AGCT 4 cut(s) 227, 278, 296, 455
AspLEI GCGC 1 cut(s) 139
AspS9I GGNCC 1 cut(s) 248
AsuHPI GGTGA 2 cut(s) 156, 341
AvaII GGWCC 1 cut(s) 248
BaeI ACNNNNGTAYC 2 cut(s) 339, 372
BanII GRGCYC 1 cut(s) 177
BbsI GAAGAC 2 cut(s) 195, 327
BccI CCATC 1 cut(s) 82
BciT130I CCWGG 2 cut(s) 231, 327
BciVI GTATCC 1 cut(s) 340
BclI TGATCA 1 cut(s) 60
BfaI CTAG 1 cut(s) 341
BfuI GTATCC 1 cut(s) 340
BlpI GCTNAGC 1 cut(s) 114
Bme1390I CCNGG 2 cut(s) 231, 327
Bme18I GGWCC 1 cut(s) 248
BmgT120I GGNCC 1 cut(s) 248
BmiI GGNNCC 1 cut(s) 428
BmrFI CCNGG 2 cut(s) 231, 327
BpiI GAAGAC 2 cut(s) 195, 327
Bpu1102I GCTNAGC 1 cut(s) 114
BsaHI GRCGYC 1 cut(s) 192
BseBI CCWGG 2 cut(s) 231, 327
BseMII CTCAG 2 cut(s) 128, 162
Bsh1236I CGCG 1 cut(s) 137
Bsp1286I GDGCHC 1 cut(s) 177
Bsp143I GATC 1 cut(s) 60
Bsp1720I GCTNAGC 1 cut(s) 114
BspACI CCGC 1 cut(s) 135
BspCNI CTCAG 2 cut(s) 127, 163
BspFNI CGCG 1 cut(s) 137
BspLI GGNNCC 1 cut(s) 428
BssMI GATC 1 cut(s) 60
BssNI GRCGYC 1 cut(s) 192
Bst2UI CCWGG 2 cut(s) 231, 327
Bst4CI ACNGT 1 cut(s) 68
BstACI GRCGYC 1 cut(s) 192
BstC8I GCNNGC 3 cut(s) 141, 225, 294
BstDEI CTNAG 2 cut(s) 114, 171
BstFNI CGCG 1 cut(s) 137
BstHHI GCGC 1 cut(s) 139
BstKTI GATC 1 cut(s) 63
BstMBI GATC 1 cut(s) 60
BstNI CCWGG 2 cut(s) 231, 327
BstSCI CCNGG 2 cut(s) 229, 325
BstUI CGCG 1 cut(s) 137
BstV2I GAAGAC 2 cut(s) 195, 327
BsuI GTATCC 1 cut(s) 340
Cac8I GCNNGC 3 cut(s) 141, 225, 294
CfoI GCGC 1 cut(s) 139
Cfr13I GGNCC 1 cut(s) 248
CviJI RGCY 6 cut(s) 92, 175, 227, 278, 296, 455
CviKI_1 RGCY 6 cut(s) 92, 175, 227, 278, 296, 455
DdeI CTNAG 2 cut(s) 114, 171
DpnI GATC 1 cut(s) 62
DpnII GATC 1 cut(s) 60
Eco24I GRGCYC 1 cut(s) 177
Eco47I GGWCC 1 cut(s) 248
EcoRII CCWGG 2 cut(s) 229, 325
EcoT38I GRGCYC 1 cut(s) 177
FaiI YATR 3 cut(s) 44, 50, 245
FbaI TGATCA 1 cut(s) 60
FriOI GRGCYC 1 cut(s) 177
FspBI CTAG 1 cut(s) 341
GlaI GCGC 1 cut(s) 138
HhaI GCGC 1 cut(s) 139
Hin1I GRCGYC 1 cut(s) 192
Hin6I GCGC 1 cut(s) 137
HinP1I GCGC 1 cut(s) 137
HinfI GANTC 2 cut(s) 146, 332
HphI GGTGA 2 cut(s) 156, 341
Hpy188I TCNGA 2 cut(s) 87, 172
Hpy188III TCNNGA 1 cut(s) 263
Hpy99I CGWCG 1 cut(s) 197
HpyAV CCTTC 7 cut(s) 119, 177, 188, 291, 305, 400, 416
HpyCH4III ACNGT 1 cut(s) 68
HpyCH4IV ACGT 2 cut(s) 192, 361
HpyCH4V TGCA 1 cut(s) 445
HpyF3I CTNAG 2 cut(s) 114, 171
HpySE526I ACGT 2 cut(s) 192, 361
Hsp92I GRCGYC 1 cut(s) 192
HspAI GCGC 1 cut(s) 137
Ksp22I TGATCA 1 cut(s) 60
Kzo9I GATC 1 cut(s) 60
LmnI GCTCC 3 cut(s) 232, 283, 301
LpnPI CCDG 7 cut(s) 198, 216, 243, 264, 302, 312, 339
MaeI CTAG 1 cut(s) 341
MaeII ACGT 2 cut(s) 192, 361
MalI GATC 1 cut(s) 62
MboI GATC 1 cut(s) 60
MboII GAAGA 5 cut(s) 141, 200, 309, 320, 327
MhlI GDGCHC 1 cut(s) 177
MluCI AATT 1 cut(s) 183
MlyI GAGTC 1 cut(s) 341
MnlI CCTC 3 cut(s) 93, 202, 270
MseI TTAA 3 cut(s) 357, 384, 457
MspR9I CCNGG 2 cut(s) 231, 327
MvaI CCWGG 2 cut(s) 231, 327
MvnI CGCG 1 cut(s) 137
NdeII GATC 1 cut(s) 60
NlaIV GGNNCC 1 cut(s) 428
PfeI GAWTC 1 cut(s) 146
PfoI TCCNGGA 1 cut(s) 229
PleI GAGTC 1 cut(s) 340
PpsI GAGTC 1 cut(s) 340
Psp6I CCWGG 2 cut(s) 229, 325
PspGI CCWGG 2 cut(s) 229, 325
PspN4I GGNNCC 1 cut(s) 428
PspPI GGNCC 1 cut(s) 248
SaqAI TTAA 3 cut(s) 357, 384, 457
Sau3AI GATC 1 cut(s) 60
Sau96I GGNCC 1 cut(s) 248
SchI GAGTC 1 cut(s) 341
ScrFI CCNGG 2 cut(s) 231, 327
SduI GDGCHC 1 cut(s) 177
SinI GGWCC 1 cut(s) 248
Sse9I AATT 1 cut(s) 183
SsiI CCGC 1 cut(s) 135
SspMI CTAG 1 cut(s) 341
StyD4I CCNGG 2 cut(s) 229, 325
TaaI ACNGT 1 cut(s) 68
TaiI ACGT 2 cut(s) 195, 364
TaqI TCGA 1 cut(s) 195
TasI AATT 1 cut(s) 183
TfiI GAWTC 1 cut(s) 146
Tru1I TTAA 3 cut(s) 357, 384, 457
Tru9I TTAA 3 cut(s) 357, 384, 457
TspDTI ATGAA 3 cut(s) 37, 138, 435
VpaK11BI GGWCC 1 cut(s) 248
XspI CTAG 1 cut(s) 341
ZraI GACGTC 1 cut(s) 193
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.