Rh2CG075900

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
OG0001143
Physical Location & Seq
Reverse (-)
6217801 .. 6221089
3289 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG075900.1

Sequence Viewer

Length: 165 bp
ATGGCTAGGGGGAAGAAACCAGTTGCTCGGCCTCATCCAACTGCTTCAGGGCTTGAAGATTCTTCAACTGCAACCTCACCTTCTGCTCCTCTTCAAATTGAAGCTCCAGCCACTTCAAGCCAGCAAGCTCCTACAATTGAATGTGTCAACATTGTAGATTTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

54

Amino Acids

5.53

Weight (kDa)

5.54

Isoelectric Point (pI)

94.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 30
AgsI TTSAA 6 cut(s) 56, 66, 95, 101, 117, 140
AluBI AGCT 2 cut(s) 104, 128
AluI AGCT 2 cut(s) 104, 128
AoxI GGCC 1 cut(s) 29
AsuHPI GGTGA 1 cut(s) 69
BfaI CTAG 1 cut(s) 6
BpmI CTGGAG 1 cut(s) 90
Bse1I ACTGG 1 cut(s) 20
BseGI GGATG 1 cut(s) 34
BseNI ACTGG 1 cut(s) 20
BseRI GAGGAG 1 cut(s) 78
BshFI GGCC 1 cut(s) 31
BsnI GGCC 1 cut(s) 31
BspANI GGCC 1 cut(s) 31
BsrI ACTGG 1 cut(s) 20
Bst6I CTCTTC 1 cut(s) 96
BstC8I GCNNGC 2 cut(s) 122, 126
BstF5I GGATG 1 cut(s) 34
BsuRI GGCC 1 cut(s) 31
BtsCI GGATG 1 cut(s) 34
Cac8I GCNNGC 2 cut(s) 122, 126
CviJI RGCY 7 cut(s) 5, 31, 52, 104, 110, 120, 128
CviKI_1 RGCY 7 cut(s) 5, 31, 52, 104, 110, 120, 128
Eam1104I CTCTTC 1 cut(s) 96
EarI CTCTTC 1 cut(s) 96
Eco57I CTGAAG 1 cut(s) 30
FokI GGATG 1 cut(s) 21
FspBI CTAG 1 cut(s) 6
GsuI CTGGAG 1 cut(s) 90
HaeIII GGCC 1 cut(s) 31
HincII GTYRAC 1 cut(s) 148
HindII GTYRAC 1 cut(s) 148
HinfI GANTC 1 cut(s) 59
HphI GGTGA 1 cut(s) 69
Hpy166II GTNNAC 1 cut(s) 148
Hpy8I GTNNAC 1 cut(s) 148
HpyAV CCTTC 1 cut(s) 90
HpyCH4V TGCA 1 cut(s) 71
LmnI GCTCC 3 cut(s) 91, 109, 133
LpnPI CCDG 4 cut(s) 33, 33, 120, 134
MaeI CTAG 1 cut(s) 6
MboII GAAGA 4 cut(s) 25, 54, 68, 83
MfeI CAATTG 1 cut(s) 135
MluCI AATT 2 cut(s) 96, 135
MmeI TCCRAC 1 cut(s) 62
MnlI CCTC 3 cut(s) 42, 85, 99
MunI CAATTG 1 cut(s) 135
NmeAIII GCCGAG 1 cut(s) 7
PfeI GAWTC 1 cut(s) 59
SetI ASST 4 cut(s) 77, 82, 106, 130
SgeI CNNG 9 cut(s) 18, 32, 39, 60, 65, 119, 129, 133, 137
Sse9I AATT 2 cut(s) 96, 135
SspMI CTAG 1 cut(s) 6
TasI AATT 2 cut(s) 96, 135
TfiI GAWTC 1 cut(s) 59
XspI CTAG 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.