Rh4AG008700

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Reverse (-)
1480937 .. 1484541
3605 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG008700.1

Sequence Viewer

Length: 204 bp
ATGAAGGACGAGCTTCGATCTATGATCCTCCAACTAGACGGCGGAGATGGAGTGATCACGACGATTCTACGAACCGCCGCCTCTACCACCGAAGACCTGCCAACACCTCCGCCCCTACCACCGCCTCCGACCGCCGTACCTCCTTCAGATTTACACGTTCAACAATCCCGAAAGCAAAGGGGAAGGGAAGGGCTGCAGTGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

67

Amino Acids

7.31

Weight (kDa)

5.61

Isoelectric Point (pI)

88.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 105
AciI CCGC 6 cut(s) 42, 75, 78, 110, 122, 132
AclWI GGATC 1 cut(s) 19
AcuI CTGAAG 1 cut(s) 129
AfaI GTAC 1 cut(s) 138
AflIII ACRYGT 1 cut(s) 154
AgsI TTSAA 1 cut(s) 161
AluBI AGCT 1 cut(s) 13
AluI AGCT 1 cut(s) 13
AlwI GGATC 1 cut(s) 19
ApeKI GCWGC 1 cut(s) 193
BaeI ACNNNNGTAYC 2 cut(s) 120, 153
BbsI GAAGAC 1 cut(s) 99
BbvI GCAGC 1 cut(s) 180
BccI CCATC 1 cut(s) 41
BceAI ACGGC 2 cut(s) 55, 119
BclI TGATCA 1 cut(s) 54
BfaI CTAG 1 cut(s) 35
BfmI CTRYAG 1 cut(s) 194
BfuAI ACCTGC 1 cut(s) 105
BisI GCNGC 2 cut(s) 78, 194
BlsI GCNGC 2 cut(s) 79, 195
BpiI GAAGAC 1 cut(s) 99
BsaXI ACNNNNNCTCC 2 cut(s) 36, 66
BseXI GCAGC 1 cut(s) 180
Bsh1285I CGRYCG 1 cut(s) 132
BsiEI CGRYCG 1 cut(s) 132
Bsp143I GATC 3 cut(s) 17, 24, 54
BspACI CCGC 6 cut(s) 42, 75, 78, 110, 122, 132
BspMAI CTGCAG 1 cut(s) 198
BspMI ACCTGC 1 cut(s) 105
BspPI GGATC 1 cut(s) 19
BssMI GATC 3 cut(s) 17, 24, 54
BstKTI GATC 3 cut(s) 20, 27, 57
BstMBI GATC 3 cut(s) 17, 24, 54
BstMCI CGRYCG 1 cut(s) 132
BstSFI CTRYAG 1 cut(s) 194
BstV1I GCAGC 1 cut(s) 180
BstV2I GAAGAC 1 cut(s) 99
BtsI GCAGTG 1 cut(s) 203
BtsIMutI CAGTG 1 cut(s) 203
BveI ACCTGC 1 cut(s) 105
Csp6I GTAC 1 cut(s) 137
CviJI RGCY 2 cut(s) 13, 193
CviKI_1 RGCY 2 cut(s) 13, 193
CviQI GTAC 1 cut(s) 137
DpnI GATC 3 cut(s) 19, 26, 56
DpnII GATC 3 cut(s) 17, 24, 54
EciI GGCGGA 2 cut(s) 57, 99
Eco57I CTGAAG 1 cut(s) 129
FaiI YATR 1 cut(s) 23
FbaI TGATCA 1 cut(s) 54
Fnu4HI GCNGC 2 cut(s) 78, 194
Fsp4HI GCNGC 2 cut(s) 78, 194
FspBI CTAG 1 cut(s) 35
GluI GCNGC 2 cut(s) 78, 194
HinfI GANTC 1 cut(s) 64
Hpy188I TCNGA 2 cut(s) 129, 148
Hpy188III TCNNGA 2 cut(s) 58, 168
Hpy99I CGWCG 1 cut(s) 64
HpyAV CCTTC 3 cut(s) 153, 177, 182
HpyCH4IV ACGT 1 cut(s) 156
HpyCH4V TGCA 1 cut(s) 196
HpySE526I ACGT 1 cut(s) 156
Ksp22I TGATCA 1 cut(s) 54
Kzo9I GATC 3 cut(s) 17, 24, 54
LpnPI CCDG 1 cut(s) 110
Lsp1109I GCAGC 1 cut(s) 180
MaeI CTAG 1 cut(s) 35
MaeII ACGT 1 cut(s) 156
MalI GATC 3 cut(s) 19, 26, 56
MboI GATC 3 cut(s) 17, 24, 54
MboII GAAGA 1 cut(s) 104
MmeI TCCRAC 2 cut(s) 55, 152
MnlI CCTC 5 cut(s) 38, 91, 117, 135, 150
NdeII GATC 3 cut(s) 17, 24, 54
PfeI GAWTC 1 cut(s) 64
PkrI GCNGC 2 cut(s) 79, 195
PstI CTGCAG 1 cut(s) 198
RsaI GTAC 1 cut(s) 138
RsaNI GTAC 1 cut(s) 137
SatI GCNGC 2 cut(s) 78, 194
Sau3AI GATC 3 cut(s) 17, 24, 54
SetI ASST 5 cut(s) 15, 99, 109, 142, 159
SfcI CTRYAG 1 cut(s) 194
SgeI CNNG 6 cut(s) 22, 47, 70, 109, 167, 180
SsiI CCGC 6 cut(s) 42, 75, 78, 110, 122, 132
SspMI CTAG 1 cut(s) 35
TaiI ACGT 1 cut(s) 159
TaqI TCGA 1 cut(s) 16
TauI GCSGC 1 cut(s) 80
TfiI GAWTC 1 cut(s) 64
TscAI CASTG 1 cut(s) 203
TseI GCWGC 1 cut(s) 193
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 203
XspI CTAG 1 cut(s) 35
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.