Rh7BG318300

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
OG0001143
Physical Location & Seq
Reverse (-)
30834456 .. 30838337
3882 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG318300.1

Sequence Viewer

Length: 231 bp
ATGGCTAGAGGGAAGAAGCCAGTTGCTCGGCCTCATCTAACTGCTTTAGGGCTTAAAGATTCTTCAGCTGCAACCTCACCTTCTGCGTCTCTTCAAATTGAAGCTCCAGGGTCTGTTCCAGCATTGGACCTCCCCAAGCTCAAGCAGTTCAACCTCGAGAATCTACGTGTAATCGCCGAGTCACCAGATCAACGCCACAGCGATCACCGAGTCGCTGCAGATTTCCATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

76

Amino Acids

8.16

Weight (kDa)

9.39

Isoelectric Point (pI)

55.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 48
AflIII ACRYGT 1 cut(s) 166
AgsI TTSAA 3 cut(s) 95, 101, 151
AjnI CCWGG 1 cut(s) 106
AluBI AGCT 3 cut(s) 68, 104, 139
AluI AGCT 3 cut(s) 68, 104, 139
Alw26I GTCTC 1 cut(s) 93
AlwNI CAGNNNCTG 1 cut(s) 113
Ama87I CYCGRG 1 cut(s) 155
AoxI GGCC 1 cut(s) 29
ApeKI GCWGC 2 cut(s) 68, 215
AspS9I GGNCC 1 cut(s) 127
AsuHPI GGTGA 3 cut(s) 69, 174, 197
AvaI CYCGRG 1 cut(s) 155
AvaII GGWCC 1 cut(s) 127
BbvI GCAGC 2 cut(s) 55, 202
BciT130I CCWGG 1 cut(s) 108
BcoDI GTCTC 1 cut(s) 93
BfaI CTAG 1 cut(s) 6
BfmI CTRYAG 1 cut(s) 216
BisI GCNGC 2 cut(s) 69, 216
BlsI GCNGC 2 cut(s) 70, 217
Bme1390I CCNGG 1 cut(s) 108
Bme18I GGWCC 1 cut(s) 127
BmeT110I CYCGRG 1 cut(s) 155
BmgT120I GGNCC 1 cut(s) 127
BmrFI CCNGG 1 cut(s) 108
BpmI CTGGAG 1 cut(s) 90
BpuEI CTTGAG 1 cut(s) 125
BsaAI YACGTR 1 cut(s) 167
BsaJI CCNNGG 1 cut(s) 107
Bse1I ACTGG 1 cut(s) 20
BseBI CCWGG 1 cut(s) 108
BseDI CCNNGG 1 cut(s) 107
BseNI ACTGG 1 cut(s) 20
BseXI GCAGC 2 cut(s) 55, 202
BshFI GGCC 1 cut(s) 31
BsiHKCI CYCGRG 1 cut(s) 155
BsmAI GTCTC 1 cut(s) 93
BsmBI CGTCTC 1 cut(s) 93
BsnI GGCC 1 cut(s) 31
BsoBI CYCGRG 1 cut(s) 155
Bsp143I GATC 2 cut(s) 187, 202
BspANI GGCC 1 cut(s) 31
BspMAI CTGCAG 1 cut(s) 220
BsrI ACTGG 1 cut(s) 20
BssECI CCNNGG 1 cut(s) 107
BssMI GATC 2 cut(s) 187, 202
Bst2UI CCWGG 1 cut(s) 108
Bst6I CTCTTC 1 cut(s) 96
BstBAI YACGTR 1 cut(s) 167
BstKTI GATC 2 cut(s) 190, 205
BstMAI GTCTC 1 cut(s) 93
BstMBI GATC 2 cut(s) 187, 202
BstNI CCWGG 1 cut(s) 108
BstSCI CCNGG 1 cut(s) 106
BstSFI CTRYAG 1 cut(s) 216
BstV1I GCAGC 2 cut(s) 55, 202
BsuRI GGCC 1 cut(s) 31
CaiI CAGNNNCTG 1 cut(s) 113
Cfr13I GGNCC 1 cut(s) 127
CseI GACGC 1 cut(s) 75
CviJI RGCY 7 cut(s) 5, 19, 31, 52, 68, 104, 139
CviKI_1 RGCY 7 cut(s) 5, 19, 31, 52, 68, 104, 139
DpnI GATC 2 cut(s) 189, 204
DpnII GATC 2 cut(s) 187, 202
Eam1104I CTCTTC 1 cut(s) 96
EarI CTCTTC 1 cut(s) 96
Eco47I GGWCC 1 cut(s) 127
Eco57I CTGAAG 1 cut(s) 48
Eco88I CYCGRG 1 cut(s) 155
EcoRII CCWGG 1 cut(s) 106
Esp3I CGTCTC 1 cut(s) 93
Fnu4HI GCNGC 2 cut(s) 69, 216
Fsp4HI GCNGC 2 cut(s) 69, 216
FspBI CTAG 1 cut(s) 6
GluI GCNGC 2 cut(s) 69, 216
GsuI CTGGAG 1 cut(s) 90
HaeIII GGCC 1 cut(s) 31
HgaI GACGC 1 cut(s) 75
HinfI GANTC 4 cut(s) 59, 160, 179, 210
HphI GGTGA 3 cut(s) 69, 174, 197
Hpy188III TCNNGA 1 cut(s) 157
HpyAV CCTTC 1 cut(s) 90
HpyCH4IV ACGT 1 cut(s) 166
HpyCH4V TGCA 2 cut(s) 71, 218
HpySE526I ACGT 1 cut(s) 166
Kzo9I GATC 2 cut(s) 187, 202
LmnI GCTCC 1 cut(s) 109
LpnPI CCDG 5 cut(s) 33, 93, 120, 132, 198
Lsp1109I GCAGC 2 cut(s) 55, 202
MaeI CTAG 1 cut(s) 6
MaeII ACGT 1 cut(s) 166
MaeIII GTNAC 1 cut(s) 180
MalI GATC 2 cut(s) 189, 204
MboI GATC 2 cut(s) 187, 202
MboII GAAGA 3 cut(s) 25, 54, 83
MluCI AATT 1 cut(s) 96
MlyI GAGTC 2 cut(s) 188, 219
MnlI CCTC 4 cut(s) 42, 85, 140, 164
MseI TTAA 1 cut(s) 54
MspA1I CMGCKG 1 cut(s) 68
MspR9I CCNGG 1 cut(s) 108
MvaI CCWGG 1 cut(s) 108
NdeII GATC 2 cut(s) 187, 202
NmeAIII GCCGAG 2 cut(s) 7, 202
NmuCI GTSAC 1 cut(s) 180
PaeR7I CTCGAG 1 cut(s) 155
PfeI GAWTC 2 cut(s) 59, 160
PkrI GCNGC 2 cut(s) 70, 217
PleI GAGTC 2 cut(s) 187, 218
PpsI GAGTC 2 cut(s) 187, 218
Ppu21I YACGTR 1 cut(s) 167
Psp6I CCWGG 1 cut(s) 106
PspGI CCWGG 1 cut(s) 106
PspPI GGNCC 1 cut(s) 127
PstI CTGCAG 1 cut(s) 220
PstNI CAGNNNCTG 1 cut(s) 113
PvuII CAGCTG 1 cut(s) 68
SaqAI TTAA 1 cut(s) 54
SatI GCNGC 2 cut(s) 69, 216
Sau3AI GATC 2 cut(s) 187, 202
Sau96I GGNCC 1 cut(s) 127
SchI GAGTC 2 cut(s) 188, 219
ScrFI CCNGG 1 cut(s) 108
SetI ASST 8 cut(s) 70, 77, 82, 106, 132, 141, 156, 169
SfcI CTRYAG 1 cut(s) 216
Sfr274I CTCGAG 1 cut(s) 155
SinI GGWCC 1 cut(s) 127
SlaI CTCGAG 1 cut(s) 155
SmlI CTYRAG 2 cut(s) 140, 155
SmoI CTYRAG 2 cut(s) 140, 155
Sse9I AATT 1 cut(s) 96
SspMI CTAG 1 cut(s) 6
StyD4I CCNGG 1 cut(s) 106
TaiI ACGT 1 cut(s) 169
TaqI TCGA 1 cut(s) 156
TasI AATT 1 cut(s) 96
TfiI GAWTC 2 cut(s) 59, 160
Tru1I TTAA 1 cut(s) 54
Tru9I TTAA 1 cut(s) 54
TseFI GTSAC 1 cut(s) 180
TseI GCWGC 2 cut(s) 68, 215
Tsp45I GTSAC 1 cut(s) 180
VpaK11BI GGWCC 1 cut(s) 127
XhoI CTCGAG 1 cut(s) 155
XspI CTAG 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.