Rmu_sc0011512.1_g000002

Zinc finger BED domain-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0011512.1
OG0001143
Physical Location & Seq
Forward (+)
3433 .. 7346
3914 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0011512.1_g000002.1.cds

Sequence Viewer

Length: 1065 bp
atgtcgtccgagacttgcaaacgaagcccagacccgattctggcatggagcttcggagcttcccggacatctgacaaacaaaaccggcgaagcccagacccgattcaggcatggagctttggagtttcccggacatctgacgaacaaaacctgcaaagcccagaggggttgggatcgtggagttggatggcgtcatccctggtggttcaacggtgggatagagctagggctgggcatagtaaaccgagttaccgaacccggtccgatcccgaaccgaaaaatgccgggacgttgaagaacagtatggctagagggaagaagatagtggctcgacctcgaccaacagcttctggtcttgaggattcttccacaggaacatcaccatcttatcctcgagctggtgaagcacaacaacaattatttcagcagattgaagctcaagctcaagctgaagaaggtgcaagtcaacctgaagctactgcagctgaagaaggtgcaagtcaacctgaagctcctccatctgtaagtgagtgtccttctactgcatctggtatcaaacgtagttttgtttgggagcattttattgaatatgataagattgaggttcagaaagatgctgagggaaatgatattgagattgttcataaacgagcttattgcaaatattgccctaggggaaaggtaggagattttgctgtggatagttctaagaatggtacttctgttttgacgtcgtccgagacttgcaaacgaagcccaaacccgattccggcgtggagcttcagagcttcccggacatctgacaaacaaaacaggcgaagcccagacctgattcaggcatggagctttggaacttcccggacatctgacgaacaaaaccggcgaagcccagacccaattcaggcgtggagagcttcccggacatctgacgaacaaaacctgcgaagcccagaggggttgggatcgtggagttggatggcgtcatccctggtggttcaacgatgggatagagcggcggcggtggaggcagacatcgaaggtggagtggtgggcgtggtggcttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4413 Dimer_Tnp_hAT zf-BED

Protein Analysis

354

Amino Acids

38.84

Weight (kDa)

8.23

Isoelectric Point (pI)

74.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 734
Acc36I ACCTGC 2 cut(s) 159, 948
AccBSI CCGCTC 1 cut(s) 1013
AciI CCGC 3 cut(s) 1013, 1016, 1019
AclWI GGATC 3 cut(s) 181, 260, 970
AcuI CTGAAG 5 cut(s) 471, 492, 507, 528, 766
AcyI GRCGYC 3 cut(s) 191, 731, 980
AfaI GTAC 1 cut(s) 718
AfiI CCNNNNNNNGG 6 cut(s) 40, 106, 398, 769, 835, 901
AgsI TTSAA 5 cut(s) 209, 295, 434, 587, 998
AjnI CCWGG 2 cut(s) 198, 987
Alw26I GTCTC 2 cut(s) 5, 734
AlwI GGATC 3 cut(s) 181, 260, 970
AlwNI CAGNNNCTG 1 cut(s) 350
Ama87I CYCGRG 1 cut(s) 393
ApeKI GCWGC 1 cut(s) 482
AspA2I CCTAGG 1 cut(s) 671
AspS9I GGNCC 1 cut(s) 261
AsuC2I CCSGG 7 cut(s) 64, 130, 259, 286, 793, 859, 919
AsuHPI GGTGA 2 cut(s) 372, 413
AvaI CYCGRG 1 cut(s) 393
AvaII GGWCC 1 cut(s) 261
AvrII CCTAGG 1 cut(s) 671
BaeI ACNNNNGTAYC 2 cut(s) 708, 741
BbvCI CCTCAGC 1 cut(s) 618
BbvI GCAGC 1 cut(s) 494
BccI CCATC 5 cut(s) 181, 391, 526, 970, 996
BcgI CGANNNNNNTGC 2 cut(s) 639, 673
BciT130I CCWGG 2 cut(s) 200, 989
BcnI CCSGG 7 cut(s) 64, 130, 259, 286, 793, 859, 919
BcoDI GTCTC 2 cut(s) 5, 734
BfaI CTAG 3 cut(s) 225, 309, 672
BfmI CTRYAG 1 cut(s) 480
BfuAI ACCTGC 2 cut(s) 159, 948
BisI GCNGC 3 cut(s) 483, 1014, 1017
BlnI CCTAGG 1 cut(s) 671
BlsI GCNGC 3 cut(s) 484, 1015, 1018
Bme1390I CCNGG 9 cut(s) 64, 130, 200, 259, 286, 793, 859, 919, 989
Bme18I GGWCC 1 cut(s) 261
BmeT110I CYCGRG 1 cut(s) 393
BmgT120I GGNCC 1 cut(s) 261
BmrFI CCNGG 9 cut(s) 64, 130, 200, 259, 286, 793, 859, 919, 989
BmsI GCATC 2 cut(s) 554, 604
Bpu10I CCTNAGC 1 cut(s) 618
BpuEI CTTGAG 3 cut(s) 377, 423, 429
BpuMI CCSGG 7 cut(s) 64, 130, 259, 286, 793, 859, 919
BsaHI GRCGYC 3 cut(s) 191, 731, 980
BsaJI CCNNGG 3 cut(s) 198, 671, 987
Bsc4I CCNNNNNNNGG 6 cut(s) 40, 106, 398, 769, 835, 901
Bse118I RCCGGY 2 cut(s) 84, 879
BseBI CCWGG 2 cut(s) 200, 989
BseDI CCNNGG 3 cut(s) 198, 671, 987
BseGI GGATG 4 cut(s) 192, 194, 981, 983
BseLI CCNNNNNNNGG 6 cut(s) 40, 106, 398, 769, 835, 901
BseMII CTCAG 1 cut(s) 609
BseRI GAGGAG 1 cut(s) 504
BseXI GCAGC 1 cut(s) 494
BseYI CCCAGC 1 cut(s) 230
BsiHKCI CYCGRG 1 cut(s) 393
BslFI GGGAC 1 cut(s) 301
BslI CCNNNNNNNGG 6 cut(s) 40, 106, 398, 769, 835, 901
BsmAI GTCTC 2 cut(s) 5, 734
BsmFI GGGAC 1 cut(s) 301
BsoBI CYCGRG 1 cut(s) 393
Bsp143I GATC 3 cut(s) 173, 265, 962
BspACI CCGC 3 cut(s) 1013, 1016, 1019
BspCNI CTCAG 1 cut(s) 610
BspMAI CTGCAG 1 cut(s) 484
BspMI ACCTGC 2 cut(s) 159, 948
BspPI GGATC 3 cut(s) 181, 260, 970
BsrBI CCGCTC 1 cut(s) 1013
BsrFI RCCGGY 2 cut(s) 84, 879
BssAI RCCGGY 2 cut(s) 84, 879
BssECI CCNNGG 3 cut(s) 198, 671, 987
BssMI GATC 3 cut(s) 173, 265, 962
BssNI GRCGYC 3 cut(s) 191, 731, 980
BssT1I CCWWGG 1 cut(s) 671
Bst2UI CCWGG 2 cut(s) 200, 989
Bst4CI ACNGT 2 cut(s) 213, 302
BstACI GRCGYC 3 cut(s) 191, 731, 980
BstAPI GCANNNNNTGC 1 cut(s) 666
BstDEI CTNAG 3 cut(s) 618, 708, 1062
BstENI CCTNNNNNAGG 1 cut(s) 833
BstF5I GGATG 4 cut(s) 192, 194, 981, 983
BstKTI GATC 3 cut(s) 176, 268, 965
BstMAI GTCTC 2 cut(s) 5, 734
BstMBI GATC 3 cut(s) 173, 265, 962
BstMWI GCNNNNNNNGC 7 cut(s) 24, 404, 482, 666, 753, 911, 1025
BstNI CCWGG 2 cut(s) 200, 989
BstSCI CCNGG 9 cut(s) 62, 128, 198, 257, 284, 791, 857, 917, 987
BstSFI CTRYAG 1 cut(s) 480
BstV1I GCAGC 1 cut(s) 494
BtsCI GGATG 4 cut(s) 192, 194, 981, 983
BveI ACCTGC 2 cut(s) 159, 948
CaiI CAGNNNCTG 1 cut(s) 350
Cfr10I RCCGGY 2 cut(s) 84, 879
Cfr13I GGNCC 1 cut(s) 261
CpoI CGGWCCG 1 cut(s) 261
CseI GACGC 2 cut(s) 180, 969
Csp6I GTAC 1 cut(s) 717
CspI CGGWCCG 1 cut(s) 261
CviAII CATG 3 cut(s) 45, 111, 840
CviQI GTAC 1 cut(s) 717
DdeI CTNAG 3 cut(s) 618, 708, 1062
DpnI GATC 3 cut(s) 175, 267, 964
DpnII GATC 3 cut(s) 173, 265, 962
Eco130I CCWWGG 1 cut(s) 671
Eco47I GGWCC 1 cut(s) 261
Eco57I CTGAAG 5 cut(s) 471, 492, 507, 528, 766
Eco88I CYCGRG 1 cut(s) 393
EcoNI CCTNNNNNAGG 1 cut(s) 833
EcoRII CCWGG 2 cut(s) 198, 987
EcoT14I CCWWGG 1 cut(s) 671
ErhI CCWWGG 1 cut(s) 671
FaeI CATG 3 cut(s) 48, 114, 843
FaiI YATR 7 cut(s) 46, 112, 237, 305, 591, 645, 841
FaqI GGGAC 1 cut(s) 301
FatI CATG 3 cut(s) 44, 110, 839
Fnu4HI GCNGC 3 cut(s) 483, 1014, 1017
FokI GGATG 4 cut(s) 181, 199, 970, 988
Fsp4HI GCNGC 3 cut(s) 483, 1014, 1017
FspBI CTAG 3 cut(s) 225, 309, 672
GluI GCNGC 3 cut(s) 483, 1014, 1017
GsaI CCCAGC 1 cut(s) 234
HgaI GACGC 2 cut(s) 180, 969
Hin1I GRCGYC 3 cut(s) 191, 731, 980
Hin1II CATG 3 cut(s) 48, 114, 843
HincII GTYRAC 2 cut(s) 467, 503
HindII GTYRAC 2 cut(s) 467, 503
HinfI GANTC 5 cut(s) 37, 103, 362, 766, 832
HphI GGTGA 2 cut(s) 372, 413
Hpy166II GTNNAC 3 cut(s) 242, 467, 503
Hpy188III TCNNGA 2 cut(s) 269, 356
Hpy8I GTNNAC 3 cut(s) 242, 467, 503
Hpy99I CGWCG 1 cut(s) 736
HpyAV CCTTC 4 cut(s) 449, 485, 546, 1031
HpyCH4III ACNGT 2 cut(s) 213, 302
HpyCH4IV ACGT 3 cut(s) 290, 559, 731
HpyCH4V TGCA 8 cut(s) 18, 154, 461, 482, 497, 545, 660, 747
HpyF10VI GCNNNNNNNGC 7 cut(s) 24, 404, 482, 666, 753, 911, 1025
HpyF3I CTNAG 3 cut(s) 618, 708, 1062
HpySE526I ACGT 3 cut(s) 290, 559, 731
Hsp92I GRCGYC 3 cut(s) 191, 731, 980
Hsp92II CATG 3 cut(s) 48, 114, 843
Kzo9I GATC 3 cut(s) 173, 265, 962
LmnI GCTCC 7 cut(s) 48, 56, 114, 517, 574, 777, 843
Lsp1109I GCAGC 1 cut(s) 494
LweI GCATC 2 cut(s) 554, 604
MaeI CTAG 3 cut(s) 225, 309, 672
MaeII ACGT 3 cut(s) 290, 559, 731
MaeIII GTNAC 1 cut(s) 248
MalI GATC 3 cut(s) 175, 267, 964
MbiI CCGCTC 1 cut(s) 1013
MboI GATC 3 cut(s) 173, 265, 962
MboII GAAGA 6 cut(s) 307, 328, 331, 357, 464, 500
MluCI AATT 2 cut(s) 416, 897
MmeI TCCRAC 2 cut(s) 164, 953
MspA1I CMGCKG 1 cut(s) 485
MspR9I CCNGG 9 cut(s) 64, 130, 200, 259, 286, 793, 859, 919, 989
MvaI CCWGG 2 cut(s) 200, 989
MwoI GCNNNNNNNGC 7 cut(s) 24, 404, 482, 666, 753, 911, 1025
NciI CCSGG 7 cut(s) 64, 130, 259, 286, 793, 859, 919
NdeII GATC 3 cut(s) 173, 265, 962
NlaIII CATG 3 cut(s) 48, 114, 843
PaeR7I CTCGAG 1 cut(s) 393
PfeI GAWTC 5 cut(s) 37, 103, 362, 766, 832
PflFI GACNNNGTC 1 cut(s) 733
PfoI TCCNGGA 5 cut(s) 62, 128, 791, 857, 917
PkrI GCNGC 3 cut(s) 484, 1015, 1018
Psp6I CCWGG 2 cut(s) 198, 987
PspFI CCCAGC 1 cut(s) 230
PspGI CCWGG 2 cut(s) 198, 987
PspPI GGNCC 1 cut(s) 261
PspXI VCTCGAGB 1 cut(s) 393
PstI CTGCAG 1 cut(s) 484
PstNI CAGNNNCTG 1 cut(s) 350
PsyI GACNNNGTC 1 cut(s) 733
PvuII CAGCTG 1 cut(s) 485
RsaI GTAC 1 cut(s) 718
RsaNI GTAC 1 cut(s) 717
Rsr2I CGGWCCG 1 cut(s) 261
RsrII CGGWCCG 1 cut(s) 261
SatI GCNGC 3 cut(s) 483, 1014, 1017
Sau3AI GATC 3 cut(s) 173, 265, 962
Sau96I GGNCC 1 cut(s) 261
ScrFI CCNGG 9 cut(s) 64, 130, 200, 259, 286, 793, 859, 919, 989
SfaNI GCATC 2 cut(s) 554, 604
SfcI CTRYAG 1 cut(s) 480
Sfr274I CTCGAG 1 cut(s) 393
SinI GGWCC 1 cut(s) 261
SlaI CTCGAG 1 cut(s) 393
SmlI CTYRAG 4 cut(s) 356, 393, 438, 444
SmoI CTYRAG 4 cut(s) 356, 393, 438, 444
Sse9I AATT 2 cut(s) 416, 897
SsiI CCGC 3 cut(s) 1013, 1016, 1019
SspI AATATT 1 cut(s) 665
SspMI CTAG 3 cut(s) 225, 309, 672
StyD4I CCNGG 9 cut(s) 62, 128, 198, 257, 284, 791, 857, 917, 987
StyI CCWWGG 1 cut(s) 671
TaaI ACNGT 2 cut(s) 213, 302
TaiI ACGT 3 cut(s) 293, 562, 734
TaqI TCGA 4 cut(s) 331, 337, 394, 1035
TasI AATT 2 cut(s) 416, 897
TauI GCSGC 2 cut(s) 1016, 1019
TfiI GAWTC 5 cut(s) 37, 103, 362, 766, 832
TseI GCWGC 1 cut(s) 482
TspDTI ATGAA 1 cut(s) 632
Tth111I GACNNNGTC 1 cut(s) 733
VpaK11BI GGWCC 1 cut(s) 261
XagI CCTNNNNNAGG 1 cut(s) 833
XcmI CCANNNNNNNNNTGG 1 cut(s) 903
XhoI CTCGAG 1 cut(s) 393
XmaJI CCTAGG 1 cut(s) 671
XspI CTAG 3 cut(s) 225, 309, 672
ZraI GACGTC 1 cut(s) 732
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.