RchiOBHm_Chr2g0096561

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0001143
Physical Location & Seq
Forward (+)
9294406 .. 9294877
472 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ47147

Sequence Viewer

Length: 156 bp
ATGGCTAGAGCGAAGAAGGAAGTTGCTCGACCTCATCCAACCGCTTCGGGGCTTGAAGACTGTTCAACCGCAACTTCACCTTCTACAAAGGGGAAGGGAAAGGCTGCAGTGGTTTTTTCAAATGTGTTTAATACTTCAAGACTTGTAGTTAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

51

Amino Acids

5.32

Weight (kDa)

10.18

Isoelectric Point (pI)

27.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 42, 69
AfiI CCNNNNNNNGG 1 cut(s) 48
AgsI TTSAA 4 cut(s) 56, 66, 120, 138
ApeKI GCWGC 1 cut(s) 104
AsuHPI GGTGA 1 cut(s) 69
BbsI GAAGAC 1 cut(s) 63
BbvI GCAGC 1 cut(s) 91
BfaI CTAG 2 cut(s) 6, 154
BfmI CTRYAG 1 cut(s) 105
BisI GCNGC 1 cut(s) 105
BlsI GCNGC 1 cut(s) 106
BpiI GAAGAC 1 cut(s) 63
Bsc4I CCNNNNNNNGG 1 cut(s) 48
BseGI GGATG 1 cut(s) 34
BseLI CCNNNNNNNGG 1 cut(s) 48
BseXI GCAGC 1 cut(s) 91
BslI CCNNNNNNNGG 1 cut(s) 48
BspACI CCGC 2 cut(s) 42, 69
BspMAI CTGCAG 1 cut(s) 109
Bst4CI ACNGT 1 cut(s) 62
BstF5I GGATG 1 cut(s) 34
BstSFI CTRYAG 1 cut(s) 105
BstV1I GCAGC 1 cut(s) 91
BstV2I GAAGAC 1 cut(s) 63
BtsCI GGATG 1 cut(s) 34
BtsI GCAGTG 1 cut(s) 114
BtsIMutI CAGTG 1 cut(s) 114
CviJI RGCY 3 cut(s) 5, 52, 104
CviKI_1 RGCY 3 cut(s) 5, 52, 104
Fnu4HI GCNGC 1 cut(s) 105
FokI GGATG 1 cut(s) 21
Fsp4HI GCNGC 1 cut(s) 105
FspBI CTAG 2 cut(s) 6, 154
GluI GCNGC 1 cut(s) 105
HincII GTYRAC 1 cut(s) 151
HindII GTYRAC 1 cut(s) 151
HpaI GTTAAC 1 cut(s) 151
HphI GGTGA 1 cut(s) 69
Hpy166II GTNNAC 1 cut(s) 151
Hpy188III TCNNGA 1 cut(s) 138
Hpy8I GTNNAC 1 cut(s) 151
HpyAV CCTTC 3 cut(s) 10, 88, 90
HpyCH4III ACNGT 1 cut(s) 62
HpyCH4V TGCA 1 cut(s) 107
KspAI GTTAAC 1 cut(s) 151
Lsp1109I GCAGC 1 cut(s) 91
MaeI CTAG 2 cut(s) 6, 154
MboII GAAGA 2 cut(s) 25, 68
MmeI TCCRAC 1 cut(s) 62
MnlI CCTC 1 cut(s) 42
MseI TTAA 2 cut(s) 129, 150
PkrI GCNGC 1 cut(s) 106
PstI CTGCAG 1 cut(s) 109
SaqAI TTAA 2 cut(s) 129, 150
SatI GCNGC 1 cut(s) 105
SetI ASST 2 cut(s) 34, 82
SfcI CTRYAG 1 cut(s) 105
SgeI CNNG 5 cut(s) 18, 39, 60, 65, 150
SsiI CCGC 2 cut(s) 42, 69
SspMI CTAG 2 cut(s) 6, 154
TaaI ACNGT 1 cut(s) 62
TaqI TCGA 1 cut(s) 28
Tru1I TTAA 2 cut(s) 129, 150
Tru9I TTAA 2 cut(s) 129, 150
TscAI CASTG 1 cut(s) 114
TseI GCWGC 1 cut(s) 104
TspRI CASTG 1 cut(s) 114
XspI CTAG 2 cut(s) 6, 154
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.