Rh3DG200000

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
OG0001143
Physical Location & Seq
Forward (+)
18156483 .. 18159771
3289 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG200000.1

Sequence Viewer

Length: 228 bp
ATGGCTAGGGGGAAGAAACCAGTTGCTCGGCCTCATCCAACTGCTGCAGGGCTTGAAGATTCTTCAACTGCAACCTCACCTTCTGCTCCTCTTCAAATTGAAGCTCCAGCCACTTCAAGCCAGCAAGCTCCTGTAAATGATGAAGCTCCTGCAACTCAAGCAGGTTCTGCAACTCCAAGTGATTCTGCTAATCCGACAATTGAATGTGTCAACATTGTAGATTTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

75

Amino Acids

7.49

Weight (kDa)

4.5

Isoelectric Point (pI)

82.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 152
AgsI TTSAA 6 cut(s) 56, 66, 95, 101, 117, 203
AluBI AGCT 3 cut(s) 104, 128, 146
AluI AGCT 3 cut(s) 104, 128, 146
AlwNI CAGNNNCTG 1 cut(s) 167
AoxI GGCC 1 cut(s) 29
ApeKI GCWGC 1 cut(s) 44
AsuHPI GGTGA 1 cut(s) 69
BbvI GCAGC 1 cut(s) 31
BfaI CTAG 1 cut(s) 6
BfmI CTRYAG 1 cut(s) 45
BfuAI ACCTGC 1 cut(s) 152
BisI GCNGC 1 cut(s) 45
BlsI GCNGC 1 cut(s) 46
BpmI CTGGAG 1 cut(s) 90
BpuEI CTTGAG 1 cut(s) 141
Bse1I ACTGG 1 cut(s) 20
BseGI GGATG 1 cut(s) 34
BseNI ACTGG 1 cut(s) 20
BseRI GAGGAG 1 cut(s) 78
BseXI GCAGC 1 cut(s) 31
BshFI GGCC 1 cut(s) 31
BsnI GGCC 1 cut(s) 31
BspANI GGCC 1 cut(s) 31
BspMAI CTGCAG 1 cut(s) 49
BspMI ACCTGC 1 cut(s) 152
BsrI ACTGG 1 cut(s) 20
Bst6I CTCTTC 1 cut(s) 96
BstAPI GCANNNNNTGC 1 cut(s) 167
BstC8I GCNNGC 2 cut(s) 122, 126
BstF5I GGATG 1 cut(s) 34
BstMWI GCNNNNNNNGC 2 cut(s) 158, 167
BstSFI CTRYAG 1 cut(s) 45
BstV1I GCAGC 1 cut(s) 31
BsuRI GGCC 1 cut(s) 31
BtsCI GGATG 1 cut(s) 34
BveI ACCTGC 1 cut(s) 152
Cac8I GCNNGC 2 cut(s) 122, 126
CaiI CAGNNNCTG 1 cut(s) 167
CviJI RGCY 8 cut(s) 5, 31, 52, 104, 110, 120, 128, 146
CviKI_1 RGCY 8 cut(s) 5, 31, 52, 104, 110, 120, 128, 146
Eam1104I CTCTTC 1 cut(s) 96
EarI CTCTTC 1 cut(s) 96
Fnu4HI GCNGC 1 cut(s) 45
FokI GGATG 1 cut(s) 21
Fsp4HI GCNGC 1 cut(s) 45
FspBI CTAG 1 cut(s) 6
GluI GCNGC 1 cut(s) 45
GsuI CTGGAG 1 cut(s) 90
HaeIII GGCC 1 cut(s) 31
HincII GTYRAC 1 cut(s) 211
HindII GTYRAC 1 cut(s) 211
HinfI GANTC 2 cut(s) 59, 182
HphI GGTGA 1 cut(s) 69
Hpy166II GTNNAC 1 cut(s) 211
Hpy188I TCNGA 1 cut(s) 195
Hpy8I GTNNAC 1 cut(s) 211
HpyAV CCTTC 1 cut(s) 90
HpyCH4V TGCA 4 cut(s) 47, 71, 152, 170
HpyF10VI GCNNNNNNNGC 2 cut(s) 158, 167
LmnI GCTCC 4 cut(s) 91, 109, 133, 151
LpnPI CCDG 7 cut(s) 33, 33, 120, 134, 144, 147, 162
Lsp1109I GCAGC 1 cut(s) 31
MaeI CTAG 1 cut(s) 6
MboII GAAGA 4 cut(s) 25, 54, 68, 83
MfeI CAATTG 1 cut(s) 198
MluCI AATT 2 cut(s) 96, 198
MmeI TCCRAC 2 cut(s) 62, 218
MnlI CCTC 3 cut(s) 42, 85, 99
MunI CAATTG 1 cut(s) 198
MwoI GCNNNNNNNGC 2 cut(s) 158, 167
NmeAIII GCCGAG 1 cut(s) 7
PfeI GAWTC 2 cut(s) 59, 182
PkrI GCNGC 1 cut(s) 46
PstI CTGCAG 1 cut(s) 49
PstNI CAGNNNCTG 1 cut(s) 167
SatI GCNGC 1 cut(s) 45
SetI ASST 6 cut(s) 77, 82, 106, 130, 148, 166
SfcI CTRYAG 1 cut(s) 45
SmlI CTYRAG 1 cut(s) 156
SmoI CTYRAG 1 cut(s) 156
Sse9I AATT 2 cut(s) 96, 198
SspMI CTAG 1 cut(s) 6
TasI AATT 2 cut(s) 96, 198
TfiI GAWTC 2 cut(s) 59, 182
TseI GCWGC 1 cut(s) 44
TspDTI ATGAA 1 cut(s) 156
XspI CTAG 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.