MD17G1275100.v1.1
ERF Family

Belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr17
Physical Location & Seq
Reverse (-)
33636517 .. 33638624
2108 bp
Loading structure...
UTR
Exon/CDS
Intron
MD17G1275100.v1.1.491

Sequence Viewer

Length: 201 bp
ATGGAGATAGATGAACATGTTCAAAGGGAAATCATGAACTATAGATCACTGGACCATCCGAATATCATTCGATCCAAAGAGATGGATGAACATGTTCAAGGGGAAATCAAGAACCACAGATCATTGAAGAATCCGAATATCATTCGATTCTCAGAGGTCAGTGATCATAAATTATTTTCGTTTTGTATTTTAAGAGGATGA

Protein Analysis

67

Amino Acids

7.93

Weight (kDa)

6.5

Isoelectric Point (pI)

52.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 66
AflIII ACRYGT 2 cut(s) 16, 91
AgsI TTSAA 3 cut(s) 23, 98, 127
AlwI GGATC 1 cut(s) 66
Asp700I GAANNNNTTC 2 cut(s) 18, 93
AspS9I GGNCC 1 cut(s) 52
AvaII GGWCC 1 cut(s) 52
BccI CCATC 2 cut(s) 63, 76
BclI TGATCA 1 cut(s) 163
BfmI CTRYAG 1 cut(s) 40
Bme18I GGWCC 1 cut(s) 52
BmgT120I GGNCC 1 cut(s) 52
Bse1I ACTGG 1 cut(s) 54
BseGI GGATG 2 cut(s) 55, 91
BseMII CTCAG 1 cut(s) 165
BseNI ACTGG 1 cut(s) 54
Bsp143I GATC 4 cut(s) 44, 71, 119, 163
BspCNI CTCAG 1 cut(s) 164
BspHI TCATGA 1 cut(s) 33
BspPI GGATC 1 cut(s) 66
BsrI ACTGG 1 cut(s) 54
BssMI GATC 4 cut(s) 44, 71, 119, 163
BstDEI CTNAG 1 cut(s) 151
BstF5I GGATG 2 cut(s) 55, 91
BstKTI GATC 4 cut(s) 47, 74, 122, 166
BstMBI GATC 4 cut(s) 44, 71, 119, 163
BstNSI RCATGY 2 cut(s) 20, 95
BstSFI CTRYAG 1 cut(s) 40
BstXI CCANNNNNNTGG 1 cut(s) 82
BtsCI GGATG 2 cut(s) 55, 91
BtsIMutI CAGTG 2 cut(s) 47, 166
CciI TCATGA 1 cut(s) 33
Cfr13I GGNCC 1 cut(s) 52
CviAII CATG 3 cut(s) 17, 34, 92
DdeI CTNAG 1 cut(s) 151
DpnI GATC 4 cut(s) 46, 73, 121, 165
DpnII GATC 4 cut(s) 44, 71, 119, 163
Eco47I GGWCC 1 cut(s) 52
FaeI CATG 3 cut(s) 20, 37, 95
FaiI YATR 5 cut(s) 18, 35, 42, 93, 168
FatI CATG 3 cut(s) 16, 33, 91
FbaI TGATCA 1 cut(s) 163
FokI GGATG 2 cut(s) 42, 98
Hin1II CATG 3 cut(s) 20, 37, 95
HinfI GANTC 2 cut(s) 130, 147
Hpy188I TCNGA 3 cut(s) 60, 135, 154
Hpy188III TCNNGA 2 cut(s) 34, 109
HpyF3I CTNAG 1 cut(s) 151
Hsp92II CATG 3 cut(s) 20, 37, 95
Ksp22I TGATCA 1 cut(s) 163
Kzo9I GATC 4 cut(s) 44, 71, 119, 163
LpnPI CCDG 1 cut(s) 35
MalI GATC 4 cut(s) 46, 73, 121, 165
MboI GATC 4 cut(s) 44, 71, 119, 163
MboII GAAGA 1 cut(s) 139
MluCI AATT 1 cut(s) 170
MnlI CCTC 2 cut(s) 148, 188
MroXI GAANNNNTTC 2 cut(s) 18, 93
MseI TTAA 1 cut(s) 191
NdeII GATC 4 cut(s) 44, 71, 119, 163
NlaIII CATG 3 cut(s) 20, 37, 95
NspI RCATGY 2 cut(s) 20, 95
PagI TCATGA 1 cut(s) 33
PciI ACATGT 2 cut(s) 16, 91
PdmI GAANNNNTTC 2 cut(s) 18, 93
PfeI GAWTC 2 cut(s) 130, 147
PscI ACATGT 2 cut(s) 16, 91
PspPI GGNCC 1 cut(s) 52
SaqAI TTAA 1 cut(s) 191
Sau3AI GATC 4 cut(s) 44, 71, 119, 163
Sau96I GGNCC 1 cut(s) 52
SetI ASST 1 cut(s) 159
SfcI CTRYAG 1 cut(s) 40
SgeI CNNG 6 cut(s) 29, 46, 62, 104, 110, 121
SinI GGWCC 1 cut(s) 52
Sse9I AATT 1 cut(s) 170
TaqI TCGA 2 cut(s) 70, 145
TasI AATT 1 cut(s) 170
TfiI GAWTC 2 cut(s) 130, 147
Tru1I TTAA 1 cut(s) 191
Tru9I TTAA 1 cut(s) 191
TscAI CASTG 2 cut(s) 54, 166
TspDTI ATGAA 3 cut(s) 27, 50, 102
TspRI CASTG 2 cut(s) 54, 166
VpaK11BI GGWCC 1 cut(s) 52
XceI RCATGY 2 cut(s) 20, 95
XmnI GAANNNNTTC 2 cut(s) 18, 93
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.