Rh3DG023400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
Physical Location & Seq
Forward (+)
1531782 .. 1532660
879 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG023400.1

Sequence Viewer

Length: 222 bp
ATGGCTAGGGGGAAGAAACCAATTGCTCGGCCTCATCCAACTGCTTCAGGGCTTGAAGATTCCTCAACTGCAACCTCACCTTCTACACCTCTTCAAATTGAAGCTCTAGCCAATTCAAGCCAGCAAGCTCCTATGGACAAGATTGAATGTGTCAACATTGTAGGTTGTAGTGCTAGGACTGTTAGAAATTTGTATTTTTATTCTGGGATGAGTGAAATATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

73

Amino Acids

7.78

Weight (kDa)

7.81

Isoelectric Point (pI)

76.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 187
AcuI CTGAAG 1 cut(s) 30
AgsI TTSAA 5 cut(s) 56, 95, 101, 117, 146
AluBI AGCT 2 cut(s) 104, 128
AluI AGCT 2 cut(s) 104, 128
AoxI GGCC 1 cut(s) 29
ApoI RAATTY 1 cut(s) 187
AsuHPI GGTGA 1 cut(s) 69
BfaI CTAG 3 cut(s) 6, 107, 174
BseGI GGATG 2 cut(s) 34, 213
BshFI GGCC 1 cut(s) 31
BsnI GGCC 1 cut(s) 31
BspANI GGCC 1 cut(s) 31
Bst4CI ACNGT 1 cut(s) 181
Bst6I CTCTTC 1 cut(s) 96
BstC8I GCNNGC 2 cut(s) 122, 126
BstF5I GGATG 2 cut(s) 34, 213
BsuRI GGCC 1 cut(s) 31
BtsCI GGATG 2 cut(s) 34, 213
Cac8I GCNNGC 2 cut(s) 122, 126
CviJI RGCY 7 cut(s) 5, 31, 52, 104, 110, 120, 128
CviKI_1 RGCY 7 cut(s) 5, 31, 52, 104, 110, 120, 128
Eam1104I CTCTTC 1 cut(s) 96
EarI CTCTTC 1 cut(s) 96
Eco57I CTGAAG 1 cut(s) 30
FaiI YATR 2 cut(s) 134, 220
FokI GGATG 1 cut(s) 21
FspBI CTAG 3 cut(s) 6, 107, 174
HaeIII GGCC 1 cut(s) 31
HincII GTYRAC 1 cut(s) 154
HindII GTYRAC 1 cut(s) 154
HinfI GANTC 1 cut(s) 59
HphI GGTGA 1 cut(s) 69
Hpy166II GTNNAC 1 cut(s) 154
Hpy8I GTNNAC 1 cut(s) 154
HpyAV CCTTC 1 cut(s) 90
HpyCH4III ACNGT 1 cut(s) 181
HpyCH4V TGCA 1 cut(s) 71
LmnI GCTCC 1 cut(s) 133
LpnPI CCDG 3 cut(s) 33, 134, 189
MaeI CTAG 3 cut(s) 6, 107, 174
MboII GAAGA 3 cut(s) 25, 68, 83
MfeI CAATTG 1 cut(s) 21
MluCI AATT 4 cut(s) 21, 96, 112, 187
MmeI TCCRAC 1 cut(s) 62
MnlI CCTC 4 cut(s) 42, 73, 85, 99
MunI CAATTG 1 cut(s) 21
NmeAIII GCCGAG 1 cut(s) 7
PfeI GAWTC 1 cut(s) 59
SetI ASST 6 cut(s) 77, 82, 91, 106, 130, 166
Sse9I AATT 4 cut(s) 21, 96, 112, 187
SspMI CTAG 3 cut(s) 6, 107, 174
TaaI ACNGT 1 cut(s) 181
TasI AATT 4 cut(s) 21, 96, 112, 187
TfiI GAWTC 1 cut(s) 59
XapI RAATTY 1 cut(s) 187
XspI CTAG 3 cut(s) 6, 107, 174
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.