Rmu_sc0001043.1_g000011

Zinc finger BED domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001043.1
Physical Location & Seq
Reverse (-)
51574 .. 52116
543 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001043.1_g000011.1.cds

Sequence Viewer

Length: 543 bp
atggctagagggaagaagatagtggctcgacatcgaccaacagcttctggtcttgaggattcttccacaggaacatcaccatcttatcctcgagctggtgaagcacaacaacaattatttcagcagattgaaactcaagctcaagctgaagaaggtgcaagtcaacctgaagctactgcagctaaagaaggtgcaagtcaacctgaagctcctccatctgtaagtgagtgtccttctactgcatctggtatcaaacgtagttttgtttgggagcattttattgaatatgataagattgaggttcagaaagatgctgagggaaatgatattgagattgttcataaacgagcttattgtaaatattgccctaggggaaaggtaggagattttgctgtggatagttctaagaatggtacttctggtatgattaggcatatcaaccaaaattgtagatattatccacctaatgtggataaatctcagaaaaatcttgctggtgatgaatcaaagggaaatagattgaccacagtagcttataactag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

180

Amino Acids

19.67

Weight (kDa)

6.9

Isoelectric Point (pI)

54.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 537
AcuI CTGAAG 3 cut(s) 168, 189, 225
AfaI GTAC 1 cut(s) 415
AfiI CCNNNNNNNGG 1 cut(s) 95
AgsI TTSAA 2 cut(s) 131, 284
AluBI AGCT 9 cut(s) 44, 95, 140, 146, 173, 182, 209, 350, 533
AluI AGCT 9 cut(s) 44, 95, 140, 146, 173, 182, 209, 350, 533
AlwNI CAGNNNCTG 1 cut(s) 47
Ama87I CYCGRG 1 cut(s) 90
ApeKI GCWGC 1 cut(s) 179
AspA2I CCTAGG 1 cut(s) 368
AsuHPI GGTGA 3 cut(s) 69, 110, 509
AvaI CYCGRG 1 cut(s) 90
AvrII CCTAGG 1 cut(s) 368
BbvCI CCTCAGC 1 cut(s) 315
BbvI GCAGC 1 cut(s) 191
BccI CCATC 2 cut(s) 88, 223
BfaI CTAG 3 cut(s) 6, 369, 541
BfmI CTRYAG 1 cut(s) 177
BisI GCNGC 1 cut(s) 180
BlnI CCTAGG 1 cut(s) 368
BlsI GCNGC 1 cut(s) 181
BmeT110I CYCGRG 1 cut(s) 90
BmsI GCATC 2 cut(s) 251, 301
Bpu10I CCTNAGC 1 cut(s) 315
BpuEI CTTGAG 3 cut(s) 74, 120, 126
BsaJI CCNNGG 1 cut(s) 368
Bsc4I CCNNNNNNNGG 1 cut(s) 95
BseDI CCNNGG 1 cut(s) 368
BseLI CCNNNNNNNGG 1 cut(s) 95
BseMII CTCAG 2 cut(s) 306, 494
BseRI GAGGAG 1 cut(s) 201
BseXI GCAGC 1 cut(s) 191
BsiHKCI CYCGRG 1 cut(s) 90
BslI CCNNNNNNNGG 1 cut(s) 95
BsoBI CYCGRG 1 cut(s) 90
BspCNI CTCAG 2 cut(s) 307, 493
BspMAI CTGCAG 1 cut(s) 181
BssECI CCNNGG 1 cut(s) 368
BssT1I CCWWGG 1 cut(s) 368
Bst4CI ACNGT 1 cut(s) 529
BstDEI CTNAG 3 cut(s) 315, 405, 480
BstMWI GCNNNNNNNGC 2 cut(s) 101, 179
BstSFI CTRYAG 1 cut(s) 177
BstV1I GCAGC 1 cut(s) 191
CaiI CAGNNNCTG 1 cut(s) 47
Csp6I GTAC 1 cut(s) 414
CviQI GTAC 1 cut(s) 414
DdeI CTNAG 3 cut(s) 315, 405, 480
Eco130I CCWWGG 1 cut(s) 368
Eco57I CTGAAG 3 cut(s) 168, 189, 225
Eco88I CYCGRG 1 cut(s) 90
EcoT14I CCWWGG 1 cut(s) 368
ErhI CCWWGG 1 cut(s) 368
FaiI YATR 5 cut(s) 288, 342, 425, 435, 537
Fnu4HI GCNGC 1 cut(s) 180
Fsp4HI GCNGC 1 cut(s) 180
FspBI CTAG 3 cut(s) 6, 369, 541
GluI GCNGC 1 cut(s) 180
HincII GTYRAC 2 cut(s) 164, 200
HindII GTYRAC 2 cut(s) 164, 200
HinfI GANTC 2 cut(s) 59, 503
HphI GGTGA 3 cut(s) 69, 110, 509
Hpy166II GTNNAC 2 cut(s) 164, 200
Hpy188I TCNGA 2 cut(s) 306, 483
Hpy188III TCNNGA 1 cut(s) 53
Hpy8I GTNNAC 2 cut(s) 164, 200
HpyAV CCTTC 3 cut(s) 146, 182, 243
HpyCH4III ACNGT 1 cut(s) 529
HpyCH4IV ACGT 1 cut(s) 256
HpyCH4V TGCA 4 cut(s) 158, 179, 194, 242
HpyF10VI GCNNNNNNNGC 2 cut(s) 101, 179
HpyF3I CTNAG 3 cut(s) 315, 405, 480
HpySE526I ACGT 1 cut(s) 256
LmnI GCTCC 2 cut(s) 214, 271
LpnPI CCDG 8 cut(s) 33, 54, 81, 180, 216, 231, 405, 480
Lsp1109I GCAGC 1 cut(s) 191
LweI GCATC 2 cut(s) 251, 301
MaeI CTAG 3 cut(s) 6, 369, 541
MaeII ACGT 1 cut(s) 256
MboII GAAGA 4 cut(s) 25, 28, 54, 161
MluCI AATT 2 cut(s) 113, 445
MnlI CCTC 5 cut(s) 49, 99, 222, 292, 310
MwoI GCNNNNNNNGC 2 cut(s) 101, 179
PaeR7I CTCGAG 1 cut(s) 90
PfeI GAWTC 2 cut(s) 59, 503
PkrI GCNGC 1 cut(s) 181
PsiI TTATAA 1 cut(s) 537
PspXI VCTCGAGB 1 cut(s) 90
PstI CTGCAG 1 cut(s) 181
PstNI CAGNNNCTG 1 cut(s) 47
RsaI GTAC 1 cut(s) 415
RsaNI GTAC 1 cut(s) 414
SatI GCNGC 1 cut(s) 180
SfaNI GCATC 2 cut(s) 251, 301
SfcI CTRYAG 1 cut(s) 177
Sfr274I CTCGAG 1 cut(s) 90
SlaI CTCGAG 1 cut(s) 90
SmlI CTYRAG 4 cut(s) 53, 90, 135, 141
SmoI CTYRAG 4 cut(s) 53, 90, 135, 141
Sse9I AATT 2 cut(s) 113, 445
SspI AATATT 1 cut(s) 362
SspMI CTAG 3 cut(s) 6, 369, 541
StyI CCWWGG 1 cut(s) 368
TaaI ACNGT 1 cut(s) 529
TaiI ACGT 1 cut(s) 259
TaqI TCGA 3 cut(s) 28, 34, 91
TasI AATT 2 cut(s) 113, 445
TfiI GAWTC 2 cut(s) 59, 503
TseI GCWGC 1 cut(s) 179
TspDTI ATGAA 2 cut(s) 329, 516
XhoI CTCGAG 1 cut(s) 90
XmaJI CCTAGG 1 cut(s) 368
XspI CTAG 3 cut(s) 6, 369, 541
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.