RchiOBHm_Chr7g0196761
ERF Family

Belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Forward (+)
14743895 .. 14744468
574 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ17601

Sequence Viewer

Length: 201 bp
ATGCGGAACCTTGAAATAGATGAAAATGTGCAAAGGGGAATCATGAACCACAGATCCTTGAAGCACCCCAATATTGTTGAATTTAAAGAGGTCCTGCTGACACCAACTCATCAAGGTATAGTAATGGAGTATGCTGAAGGAGGAGAACTGTATGAGAGAATTTGCAAGGCTGGTAAATTTAGTGAGGATGATGCAAAGTAA

Protein Analysis

66

Amino Acids

7.63

Weight (kDa)

5.52

Isoelectric Point (pI)

24.1

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pkinase PF00069 7 - 66 2.9e-09 Protein kinase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 4
AclWI GGATC 1 cut(s) 48
AcsI RAATTY 3 cut(s) 80, 159, 176
AcuI CTGAAG 1 cut(s) 156
AgsI TTSAA 3 cut(s) 14, 61, 80
AloI GAACNNNNNNTCC 2 cut(s) 38, 70
AlwI GGATC 1 cut(s) 48
ApoI RAATTY 3 cut(s) 80, 159, 176
AspS9I GGNCC 1 cut(s) 91
AvaII GGWCC 1 cut(s) 91
Bme18I GGWCC 1 cut(s) 91
BmgT120I GGNCC 1 cut(s) 91
BmiI GGNNCC 1 cut(s) 8
BmsI GCATC 1 cut(s) 181
BseGI GGATG 1 cut(s) 193
BseRI GAGGAG 1 cut(s) 156
Bsp143I GATC 1 cut(s) 53
BspACI CCGC 1 cut(s) 4
BspHI TCATGA 1 cut(s) 42
BspLI GGNNCC 1 cut(s) 8
BspPI GGATC 1 cut(s) 48
BssMI GATC 1 cut(s) 53
Bst4CI ACNGT 1 cut(s) 150
BstF5I GGATG 1 cut(s) 193
BstKTI GATC 1 cut(s) 56
BstMBI GATC 1 cut(s) 53
BstX2I RGATCY 1 cut(s) 53
BstYI RGATCY 1 cut(s) 53
BtsCI GGATG 1 cut(s) 193
CciI TCATGA 1 cut(s) 42
Cfr13I GGNCC 1 cut(s) 91
CviAII CATG 1 cut(s) 43
CviJI RGCY 1 cut(s) 170
CviKI_1 RGCY 1 cut(s) 170
DpnI GATC 1 cut(s) 55
DpnII GATC 1 cut(s) 53
DraI TTTAAA 1 cut(s) 85
Eco47I GGWCC 1 cut(s) 91
Eco57I CTGAAG 1 cut(s) 156
EcoO109I RGGNCCY 1 cut(s) 91
FaeI CATG 1 cut(s) 46
FaiI YATR 4 cut(s) 44, 119, 132, 153
FatI CATG 1 cut(s) 42
Hin1II CATG 1 cut(s) 46
HinfI GANTC 1 cut(s) 39
Hpy188III TCNNGA 1 cut(s) 43
HpyAV CCTTC 1 cut(s) 131
HpyCH4III ACNGT 1 cut(s) 150
HpyCH4V TGCA 3 cut(s) 31, 165, 194
Hsp92II CATG 1 cut(s) 46
Kzo9I GATC 1 cut(s) 53
LpnPI CCDG 2 cut(s) 107, 156
LweI GCATC 1 cut(s) 181
MalI GATC 1 cut(s) 55
MboI GATC 1 cut(s) 53
MflI RGATCY 1 cut(s) 53
MluCI AATT 3 cut(s) 80, 159, 176
MnlI CCTC 3 cut(s) 82, 134, 178
MseI TTAA 1 cut(s) 84
NdeII GATC 1 cut(s) 53
NlaIII CATG 1 cut(s) 46
NlaIV GGNNCC 1 cut(s) 8
PagI TCATGA 1 cut(s) 42
PfeI GAWTC 1 cut(s) 39
PpuMI RGGWCCY 1 cut(s) 91
Psp5II RGGWCCY 1 cut(s) 91
PspN4I GGNNCC 1 cut(s) 8
PspPI GGNCC 1 cut(s) 91
PspPPI RGGWCCY 1 cut(s) 91
PsuI RGATCY 1 cut(s) 53
SaqAI TTAA 1 cut(s) 84
Sau3AI GATC 1 cut(s) 53
Sau96I GGNCC 1 cut(s) 91
SetI ASST 3 cut(s) 12, 93, 118
SfaNI GCATC 1 cut(s) 181
SgeI CNNG 7 cut(s) 23, 55, 70, 106, 125, 178, 183
SinI GGWCC 1 cut(s) 91
Sse9I AATT 3 cut(s) 80, 159, 176
SsiI CCGC 1 cut(s) 4
SspI AATATT 1 cut(s) 73
TaaI ACNGT 1 cut(s) 150
TasI AATT 3 cut(s) 80, 159, 176
TfiI GAWTC 1 cut(s) 39
Tru1I TTAA 1 cut(s) 84
Tru9I TTAA 1 cut(s) 84
TspDTI ATGAA 2 cut(s) 36, 59
VpaK11BI GGWCC 1 cut(s) 91
XapI RAATTY 3 cut(s) 80, 159, 176
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.