pycom04g00150
ERF Family

Belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr4
Physical Location & Seq
Reverse (-)
79250 .. 79806
557 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom04g00150.4

Sequence Viewer

Length: 189 bp
ATGGAGGTAGATGAACATGTTCGAAGGGAAATCATGAGCCATAGATCACTGAAGCATCCGAATATCATTCGATCCAAAGAGATGCAGATGGATGAACATGTTCAAAGGGAAATCACAAACCATAAATCACTGAAGAATCCGAATATCATTCGATTCAAAGAGTTACTTTTCAACATCCGACAACACTGA

Protein Analysis

63

Amino Acids

7.67

Weight (kDa)

9.81

Isoelectric Point (pI)

60.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 66
AcuI CTGAAG 2 cut(s) 71, 152
AflIII ACRYGT 2 cut(s) 16, 97
AgsI TTSAA 3 cut(s) 104, 157, 172
AlwI GGATC 1 cut(s) 66
Asp700I GAANNNNTTC 2 cut(s) 18, 99
AsuII TTCGAA 1 cut(s) 22
BccI CCATC 1 cut(s) 82
BmsI GCATC 2 cut(s) 64, 72
Bpu14I TTCGAA 1 cut(s) 22
BseGI GGATG 3 cut(s) 55, 97, 174
Bsp119I TTCGAA 1 cut(s) 22
Bsp143I GATC 2 cut(s) 44, 71
BspHI TCATGA 1 cut(s) 33
BspPI GGATC 1 cut(s) 66
BspT104I TTCGAA 1 cut(s) 22
BssMI GATC 2 cut(s) 44, 71
BstBI TTCGAA 1 cut(s) 22
BstF5I GGATG 3 cut(s) 55, 97, 174
BstKTI GATC 2 cut(s) 47, 74
BstMBI GATC 2 cut(s) 44, 71
BstNSI RCATGY 2 cut(s) 20, 101
BtsCI GGATG 3 cut(s) 55, 97, 174
BtsIMutI CAGTG 3 cut(s) 47, 128, 184
CciI TCATGA 1 cut(s) 33
CviAII CATG 3 cut(s) 17, 34, 98
CviJI RGCY 1 cut(s) 39
CviKI_1 RGCY 1 cut(s) 39
DpnI GATC 2 cut(s) 46, 73
DpnII GATC 2 cut(s) 44, 71
Eco57I CTGAAG 2 cut(s) 71, 152
FaeI CATG 3 cut(s) 20, 37, 101
FaiI YATR 5 cut(s) 18, 35, 42, 99, 123
FalI AAGNNNNNCTT 2 cut(s) 150, 182
FatI CATG 3 cut(s) 16, 33, 97
FokI GGATG 3 cut(s) 42, 104, 161
Hin1II CATG 3 cut(s) 20, 37, 101
HinfI GANTC 2 cut(s) 136, 153
Hpy188I TCNGA 3 cut(s) 60, 141, 179
Hpy188III TCNNGA 1 cut(s) 34
HpyAV CCTTC 1 cut(s) 18
HpyCH4V TGCA 1 cut(s) 85
Hsp92II CATG 3 cut(s) 20, 37, 101
Kzo9I GATC 2 cut(s) 44, 71
LweI GCATC 2 cut(s) 64, 72
MaeIII GTNAC 1 cut(s) 162
MalI GATC 2 cut(s) 46, 73
MboI GATC 2 cut(s) 44, 71
MboII GAAGA 1 cut(s) 145
MroXI GAANNNNTTC 2 cut(s) 18, 99
NdeII GATC 2 cut(s) 44, 71
NlaIII CATG 3 cut(s) 20, 37, 101
NspI RCATGY 2 cut(s) 20, 101
NspV TTCGAA 1 cut(s) 22
PagI TCATGA 1 cut(s) 33
PciI ACATGT 2 cut(s) 16, 97
PdmI GAANNNNTTC 2 cut(s) 18, 99
PfeI GAWTC 2 cut(s) 136, 153
PscI ACATGT 2 cut(s) 16, 97
Sau3AI GATC 2 cut(s) 44, 71
SetI ASST 1 cut(s) 9
SfaNI GCATC 2 cut(s) 64, 72
SfuI TTCGAA 1 cut(s) 22
SgeI CNNG 3 cut(s) 29, 46, 110
TaqI TCGA 3 cut(s) 22, 70, 151
TfiI GAWTC 2 cut(s) 136, 153
TscAI CASTG 2 cut(s) 54, 135
TspDTI ATGAA 2 cut(s) 27, 108
TspRI CASTG 2 cut(s) 54, 135
XceI RCATGY 2 cut(s) 20, 101
XmnI GAANNNNTTC 2 cut(s) 18, 99
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.