Rmu_co8316865.1_g000001
ERF Family

Belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8316865.1
Physical Location & Seq
Forward (+)
65 .. 935
871 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8316865.1_g000001.1.cds

Sequence Viewer

Length: 329 bp
atgaaccacagatccttgaagcaccccaatattgttgaatttaaagaggtcctgctgacaccaactcatctaggtatagtaatggagtatgctgcaggaggagaactgtatgagagaatttgcaaggctggtaaatttagtgagaatgaggcaaggtttttcttccagcaattgatatcaggacttacgtactgtcataaaatgcatatatgtcatagagatcttaagcttgaaaattcactcttagatggcggcacaacacctcgtgtgaaaatatgcgatttcggatactcaaaggtatttcacagaacccatgatctttcaatttt

Protein Analysis

109

Amino Acids

12.58

Weight (kDa)

8.39

Isoelectric Point (pI)

34.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 252
AclWI GGATC 1 cut(s) 6
AcsI RAATTY 4 cut(s) 38, 117, 134, 235
AdeI CACNNNGTG 1 cut(s) 266
AfaI GTAC 1 cut(s) 191
AflII CTTAAG 1 cut(s) 224
AgsI TTSAA 4 cut(s) 19, 38, 233, 324
AloI GAACNNNNNNTCC 1 cut(s) 28
AluBI AGCT 1 cut(s) 229
AluI AGCT 1 cut(s) 229
AlwI GGATC 1 cut(s) 6
ApeKI GCWGC 1 cut(s) 92
ApoI RAATTY 4 cut(s) 38, 117, 134, 235
AspS9I GGNCC 1 cut(s) 49
AvaII GGWCC 1 cut(s) 49
BauI CACGAG 1 cut(s) 264
BbvI GCAGC 1 cut(s) 79
BccI CCATC 1 cut(s) 242
BciVI GTATCC 1 cut(s) 281
BfaI CTAG 1 cut(s) 71
BfmI CTRYAG 1 cut(s) 93
BfrI CTTAAG 1 cut(s) 224
BfuI GTATCC 1 cut(s) 281
BglII AGATCT 1 cut(s) 220
BisI GCNGC 2 cut(s) 93, 253
BlsI GCNGC 2 cut(s) 94, 254
Bme18I GGWCC 1 cut(s) 49
BmgT120I GGNCC 1 cut(s) 49
BsaAI YACGTR 1 cut(s) 189
BseRI GAGGAG 1 cut(s) 114
BseXI GCAGC 1 cut(s) 79
Bsp143I GATC 3 cut(s) 11, 220, 316
BspACI CCGC 1 cut(s) 252
BspMAI CTGCAG 1 cut(s) 97
BspPI GGATC 1 cut(s) 6
BspTI CTTAAG 1 cut(s) 224
BssMI GATC 3 cut(s) 11, 220, 316
BssSI CACGAG 1 cut(s) 264
Bst2BI CACGAG 1 cut(s) 264
Bst4CI ACNGT 2 cut(s) 108, 194
BstAFI CTTAAG 1 cut(s) 224
BstBAI YACGTR 1 cut(s) 189
BstDEI CTNAG 1 cut(s) 244
BstKTI GATC 3 cut(s) 14, 223, 319
BstMBI GATC 3 cut(s) 11, 220, 316
BstSFI CTRYAG 1 cut(s) 93
BstSNI TACGTA 1 cut(s) 189
BstV1I GCAGC 1 cut(s) 79
BstX2I RGATCY 2 cut(s) 11, 220
BstYI RGATCY 2 cut(s) 11, 220
BsuI GTATCC 1 cut(s) 281
Cfr13I GGNCC 1 cut(s) 49
Csp6I GTAC 1 cut(s) 190
CviAII CATG 1 cut(s) 314
CviJI RGCY 2 cut(s) 128, 229
CviKI_1 RGCY 2 cut(s) 128, 229
CviQI GTAC 1 cut(s) 190
DdeI CTNAG 1 cut(s) 244
DpnI GATC 3 cut(s) 13, 222, 318
DpnII GATC 3 cut(s) 11, 220, 316
DraI TTTAAA 1 cut(s) 43
DraIII CACNNNGTG 1 cut(s) 266
Eco105I TACGTA 1 cut(s) 189
Eco32I GATATC 1 cut(s) 177
Eco47I GGWCC 1 cut(s) 49
EcoO109I RGGNCCY 1 cut(s) 49
EcoRV GATATC 1 cut(s) 177
EcoT22I ATGCAT 1 cut(s) 207
FaeI CATG 1 cut(s) 317
FatI CATG 1 cut(s) 313
Fnu4HI GCNGC 2 cut(s) 93, 253
Fsp4HI GCNGC 2 cut(s) 93, 253
FspBI CTAG 1 cut(s) 71
GluI GCNGC 2 cut(s) 93, 253
Hin1II CATG 1 cut(s) 317
HindIII AAGCTT 1 cut(s) 227
Hpy188I TCNGA 1 cut(s) 287
Hpy188III TCNNGA 1 cut(s) 180
HpyCH4III ACNGT 2 cut(s) 108, 194
HpyCH4IV ACGT 1 cut(s) 188
HpyCH4V TGCA 3 cut(s) 95, 123, 205
HpyF3I CTNAG 1 cut(s) 244
HpySE526I ACGT 1 cut(s) 188
Hsp92II CATG 1 cut(s) 317
Kzo9I GATC 3 cut(s) 11, 220, 316
LpnPI CCDG 5 cut(s) 65, 81, 114, 165, 179
Lsp1109I GCAGC 1 cut(s) 79
MaeI CTAG 1 cut(s) 71
MaeII ACGT 1 cut(s) 188
MalI GATC 3 cut(s) 13, 222, 318
MboI GATC 3 cut(s) 11, 220, 316
MboII GAAGA 1 cut(s) 154
MfeI CAATTG 1 cut(s) 170
MflI RGATCY 2 cut(s) 11, 220
MluCI AATT 6 cut(s) 38, 117, 134, 170, 235, 324
MnlI CCTC 4 cut(s) 40, 92, 142, 273
Mph1103I ATGCAT 1 cut(s) 207
MseI TTAA 2 cut(s) 42, 225
MspCI CTTAAG 1 cut(s) 224
MunI CAATTG 1 cut(s) 170
NdeII GATC 3 cut(s) 11, 220, 316
NlaIII CATG 1 cut(s) 317
NsiI ATGCAT 1 cut(s) 207
PkrI GCNGC 2 cut(s) 94, 254
Ppu21I YACGTR 1 cut(s) 189
PpuMI RGGWCCY 1 cut(s) 49
Psp5II RGGWCCY 1 cut(s) 49
PspPI GGNCC 1 cut(s) 49
PspPPI RGGWCCY 1 cut(s) 49
PstI CTGCAG 1 cut(s) 97
PsuI RGATCY 2 cut(s) 11, 220
RsaI GTAC 1 cut(s) 191
RsaNI GTAC 1 cut(s) 190
SaqAI TTAA 2 cut(s) 42, 225
SatI GCNGC 2 cut(s) 93, 253
Sau3AI GATC 3 cut(s) 11, 220, 316
Sau96I GGNCC 1 cut(s) 49
SetI ASST 7 cut(s) 51, 76, 158, 191, 231, 265, 300
SfcI CTRYAG 1 cut(s) 93
SinI GGWCC 1 cut(s) 49
SmlI CTYRAG 1 cut(s) 224
SmoI CTYRAG 1 cut(s) 224
SnaBI TACGTA 1 cut(s) 189
Sse9I AATT 6 cut(s) 38, 117, 134, 170, 235, 324
SsiI CCGC 1 cut(s) 252
SspI AATATT 1 cut(s) 31
SspMI CTAG 1 cut(s) 71
TaaI ACNGT 2 cut(s) 108, 194
TaiI ACGT 1 cut(s) 191
TasI AATT 6 cut(s) 38, 117, 134, 170, 235, 324
TauI GCSGC 1 cut(s) 255
Tru1I TTAA 2 cut(s) 42, 225
Tru9I TTAA 2 cut(s) 42, 225
TseI GCWGC 1 cut(s) 92
TspDTI ATGAA 1 cut(s) 17
Vha464I CTTAAG 1 cut(s) 224
VpaK11BI GGWCC 1 cut(s) 49
XapI RAATTY 4 cut(s) 38, 117, 134, 235
XspI CTAG 1 cut(s) 71
Zsp2I ATGCAT 1 cut(s) 207
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.