Rh4BG374400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
Physical Location & Seq
Reverse (-)
53081390 .. 53085454
4065 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG374400.1

Sequence Viewer

Length: 225 bp
ATGGCTAGGGGGAAGAAACCAGTTGCTCGGCCTCATCCAACTGCTTCAGGGCTTGAAGATTCTTCAACTGCAACCTCACCTTCTGCTCCTTCTGCTCCTCTTCAAATTGAAGCTCCAGCCACGTCAAGCCAGCAAGCTCCTGTAAATGATGAAGCTTCTGCAACTCAAGCAGGTTCTGCAACTCCAAGTGATTCTGCTAATCCGTACGTGTTGCTGGTGCTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

74

Amino Acids

7.36

Weight (kDa)

4.95

Isoelectric Point (pI)

69.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 161
AcuI CTGAAG 1 cut(s) 30
AfaI GTAC 1 cut(s) 206
AflIII ACRYGT 1 cut(s) 207
AgsI TTSAA 4 cut(s) 56, 66, 104, 110
AjiI CACGTC 1 cut(s) 123
AluBI AGCT 3 cut(s) 113, 137, 155
AluI AGCT 3 cut(s) 113, 137, 155
AlwNI CAGNNNCTG 1 cut(s) 176
AoxI GGCC 1 cut(s) 29
AsuHPI GGTGA 1 cut(s) 69
BfaI CTAG 1 cut(s) 6
BfuAI ACCTGC 1 cut(s) 161
BmgBI CACGTC 1 cut(s) 123
BpmI CTGGAG 1 cut(s) 99
BpuEI CTTGAG 1 cut(s) 150
BsaAI YACGTR 1 cut(s) 208
Bse1I ACTGG 1 cut(s) 20
BseGI GGATG 1 cut(s) 34
BseNI ACTGG 1 cut(s) 20
BseRI GAGGAG 1 cut(s) 87
BshFI GGCC 1 cut(s) 31
BsiWI CGTACG 1 cut(s) 204
BsnI GGCC 1 cut(s) 31
BspANI GGCC 1 cut(s) 31
BspMI ACCTGC 1 cut(s) 161
BsrI ACTGG 1 cut(s) 20
Bst6I CTCTTC 1 cut(s) 105
BstAPI GCANNNNNTGC 1 cut(s) 176
BstBAI YACGTR 1 cut(s) 208
BstC8I GCNNGC 2 cut(s) 131, 135
BstF5I GGATG 1 cut(s) 34
BstMWI GCNNNNNNNGC 3 cut(s) 92, 167, 176
BsuRI GGCC 1 cut(s) 31
BtrI CACGTC 1 cut(s) 123
BtsCI GGATG 1 cut(s) 34
BveI ACCTGC 1 cut(s) 161
Cac8I GCNNGC 2 cut(s) 131, 135
CaiI CAGNNNCTG 1 cut(s) 176
Csp6I GTAC 1 cut(s) 205
CviJI RGCY 8 cut(s) 5, 31, 52, 113, 119, 129, 137, 155
CviKI_1 RGCY 8 cut(s) 5, 31, 52, 113, 119, 129, 137, 155
CviQI GTAC 1 cut(s) 205
Eam1104I CTCTTC 1 cut(s) 105
EarI CTCTTC 1 cut(s) 105
Eco57I CTGAAG 1 cut(s) 30
FaiI YATR 1 cut(s) 223
FokI GGATG 1 cut(s) 21
FspBI CTAG 1 cut(s) 6
GsuI CTGGAG 1 cut(s) 99
HaeIII GGCC 1 cut(s) 31
HindIII AAGCTT 1 cut(s) 153
HinfI GANTC 2 cut(s) 59, 191
HphI GGTGA 1 cut(s) 69
HpyAV CCTTC 2 cut(s) 90, 99
HpyCH4IV ACGT 2 cut(s) 122, 207
HpyCH4V TGCA 3 cut(s) 71, 161, 179
HpyF10VI GCNNNNNNNGC 3 cut(s) 92, 167, 176
HpySE526I ACGT 2 cut(s) 122, 207
LmnI GCTCC 4 cut(s) 91, 100, 118, 142
LpnPI CCDG 7 cut(s) 33, 33, 129, 143, 153, 156, 200
MaeI CTAG 1 cut(s) 6
MaeII ACGT 2 cut(s) 122, 207
MboII GAAGA 4 cut(s) 25, 54, 68, 92
MluCI AATT 1 cut(s) 105
MmeI TCCRAC 1 cut(s) 62
MnlI CCTC 3 cut(s) 42, 85, 108
MwoI GCNNNNNNNGC 3 cut(s) 92, 167, 176
NmeAIII GCCGAG 1 cut(s) 7
PfeI GAWTC 2 cut(s) 59, 191
Pfl23II CGTACG 1 cut(s) 204
Ppu21I YACGTR 1 cut(s) 208
PspLI CGTACG 1 cut(s) 204
PstNI CAGNNNCTG 1 cut(s) 176
RsaI GTAC 1 cut(s) 206
RsaNI GTAC 1 cut(s) 205
SetI ASST 8 cut(s) 77, 82, 115, 125, 139, 157, 175, 210
SmlI CTYRAG 1 cut(s) 165
SmoI CTYRAG 1 cut(s) 165
Sse9I AATT 1 cut(s) 105
SspMI CTAG 1 cut(s) 6
TaiI ACGT 2 cut(s) 125, 210
TasI AATT 1 cut(s) 105
TfiI GAWTC 2 cut(s) 59, 191
TspDTI ATGAA 1 cut(s) 165
TspGWI ACGGA 1 cut(s) 192
XspI CTAG 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.