Rmu_sc0000556.1_g000020

Zinc finger BED domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000556.1
Physical Location & Seq
Forward (+)
88060 .. 88455
396 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000556.1_g000020.1.cds

Sequence Viewer

Length: 396 bp
atggctagggggaagaaactagttgctcggcctcatccaactgcttcagggcttgaagattcttcaactgcaacctcaccttctgctcctcttcaaattgaagctctagccacttcaagccagcaagctcctacgggttcaagccagcaagctcctataaatgatgaagctcctgcaactcaagtaggttctgcaactccaagtgattctgctaatccggttagttctgctaaacatagttttggttgggaacattttaaggagtatgacaagattgagaagggtaaagatgctgaagggaatgagataggcattgttaaaaaaacagctcactgcatttactgtcctagagggaaaattggagactttgcagtggatagttctaagagtggatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

131

Amino Acids

13.61

Weight (kDa)

6.41

Isoelectric Point (pI)

44.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 2 cut(s) 30, 315
AgsI TTSAA 6 cut(s) 56, 66, 95, 101, 117, 141
AhlI ACTAGT 1 cut(s) 19
AluBI AGCT 5 cut(s) 104, 128, 152, 170, 329
AluI AGCT 5 cut(s) 104, 128, 152, 170, 329
Alw26I GTCTC 1 cut(s) 357
AoxI GGCC 1 cut(s) 29
AsuHPI GGTGA 1 cut(s) 69
BcoDI GTCTC 1 cut(s) 357
BcuI ACTAGT 1 cut(s) 19
BfaI CTAG 4 cut(s) 6, 20, 107, 348
BmsI GCATC 1 cut(s) 280
BpuEI CTTGAG 1 cut(s) 165
BsaWI WCCGGW 1 cut(s) 217
BseGI GGATG 1 cut(s) 34
BseRI GAGGAG 1 cut(s) 78
BshFI GGCC 1 cut(s) 31
BsiSI CCGG 1 cut(s) 218
BsmAI GTCTC 1 cut(s) 357
BsnI GGCC 1 cut(s) 31
BspANI GGCC 1 cut(s) 31
Bst4CI ACNGT 1 cut(s) 344
Bst6I CTCTTC 1 cut(s) 96
BstC8I GCNNGC 4 cut(s) 122, 126, 146, 150
BstDEI CTNAG 1 cut(s) 384
BstF5I GGATG 1 cut(s) 34
BstMAI GTCTC 1 cut(s) 357
BsuRI GGCC 1 cut(s) 31
BtsCI GGATG 1 cut(s) 34
BtsI GCAGTG 2 cut(s) 331, 378
BtsIMutI CAGTG 2 cut(s) 331, 378
Cac8I GCNNGC 4 cut(s) 122, 126, 146, 150
DdeI CTNAG 1 cut(s) 384
Eam1104I CTCTTC 1 cut(s) 96
EarI CTCTTC 1 cut(s) 96
Eco57I CTGAAG 2 cut(s) 30, 315
FaiI YATR 3 cut(s) 158, 237, 267
FokI GGATG 1 cut(s) 21
FspBI CTAG 4 cut(s) 6, 20, 107, 348
HaeIII GGCC 1 cut(s) 31
HapII CCGG 1 cut(s) 218
HinfI GANTC 2 cut(s) 59, 206
HpaII CCGG 1 cut(s) 218
HphI GGTGA 1 cut(s) 69
HpyAV CCTTC 3 cut(s) 90, 274, 290
HpyCH4III ACNGT 1 cut(s) 344
HpyCH4V TGCA 5 cut(s) 71, 176, 194, 336, 371
HpyF3I CTNAG 1 cut(s) 384
LmnI GCTCC 4 cut(s) 91, 133, 157, 175
LpnPI CCDG 5 cut(s) 33, 134, 158, 186, 231
LweI GCATC 1 cut(s) 280
MaeI CTAG 4 cut(s) 6, 20, 107, 348
MboII GAAGA 4 cut(s) 25, 54, 68, 83
MluCI AATT 2 cut(s) 96, 357
MmeI TCCRAC 1 cut(s) 62
MnlI CCTC 4 cut(s) 42, 85, 99, 344
MseI TTAA 2 cut(s) 258, 318
MspI CCGG 1 cut(s) 218
NmeAIII GCCGAG 1 cut(s) 7
PfeI GAWTC 2 cut(s) 59, 206
SaqAI TTAA 2 cut(s) 258, 318
SetI ASST 8 cut(s) 77, 82, 106, 130, 154, 172, 190, 331
SfaNI GCATC 1 cut(s) 280
SmlI CTYRAG 1 cut(s) 180
SmoI CTYRAG 1 cut(s) 180
SpeI ACTAGT 1 cut(s) 19
Sse9I AATT 2 cut(s) 96, 357
SspMI CTAG 4 cut(s) 6, 20, 107, 348
TaaI ACNGT 1 cut(s) 344
TasI AATT 2 cut(s) 96, 357
TfiI GAWTC 2 cut(s) 59, 206
Tru1I TTAA 2 cut(s) 258, 318
Tru9I TTAA 2 cut(s) 258, 318
TscAI CASTG 2 cut(s) 338, 378
TspDTI ATGAA 1 cut(s) 180
TspRI CASTG 2 cut(s) 338, 378
XspI CTAG 4 cut(s) 6, 20, 107, 348
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.