RchiOBHm_Chr3g0449891

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
OG0001143
Physical Location & Seq
Forward (+)
1558207 .. 1558919
713 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ41724

Sequence Viewer

Length: 162 bp
ATGGCTAGGGGGAAGAAACCAATTGCTCGGCCTCATCCAACTGCTTCAGGGCTTGAAGATTCCTCAATTGCAACCTCACCTTCTGCACCTCTTCAAATTGAAGCTCTAGCCAATTCAAGCCAGCAAGCTCCTATGGGTTCAACCTCACTTTCATTGTGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

53

Amino Acids

5.36

Weight (kDa)

7.98

Isoelectric Point (pI)

64.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 30
AgsI TTSAA 5 cut(s) 56, 95, 101, 117, 141
AluBI AGCT 2 cut(s) 104, 128
AluI AGCT 2 cut(s) 104, 128
AoxI GGCC 1 cut(s) 29
AsuHPI GGTGA 1 cut(s) 69
BfaI CTAG 2 cut(s) 6, 107
BseGI GGATG 1 cut(s) 34
BsgI GTGCAG 1 cut(s) 69
BshFI GGCC 1 cut(s) 31
BsnI GGCC 1 cut(s) 31
BspANI GGCC 1 cut(s) 31
Bst6I CTCTTC 1 cut(s) 96
BstC8I GCNNGC 2 cut(s) 122, 126
BstF5I GGATG 1 cut(s) 34
BsuRI GGCC 1 cut(s) 31
BtsCI GGATG 1 cut(s) 34
Cac8I GCNNGC 2 cut(s) 122, 126
CviJI RGCY 7 cut(s) 5, 31, 52, 104, 110, 120, 128
CviKI_1 RGCY 7 cut(s) 5, 31, 52, 104, 110, 120, 128
Eam1104I CTCTTC 1 cut(s) 96
EarI CTCTTC 1 cut(s) 96
Eco57I CTGAAG 1 cut(s) 30
FaiI YATR 1 cut(s) 134
FokI GGATG 1 cut(s) 21
FspBI CTAG 2 cut(s) 6, 107
HaeIII GGCC 1 cut(s) 31
HinfI GANTC 1 cut(s) 59
HphI GGTGA 1 cut(s) 69
HpyAV CCTTC 1 cut(s) 90
HpyCH4V TGCA 2 cut(s) 71, 86
LmnI GCTCC 1 cut(s) 133
LpnPI CCDG 2 cut(s) 33, 134
MaeI CTAG 2 cut(s) 6, 107
MboII GAAGA 3 cut(s) 25, 68, 83
MfeI CAATTG 2 cut(s) 21, 66
MluCI AATT 4 cut(s) 21, 66, 96, 112
MmeI TCCRAC 1 cut(s) 62
MnlI CCTC 5 cut(s) 42, 73, 85, 99, 154
MunI CAATTG 2 cut(s) 21, 66
NmeAIII GCCGAG 1 cut(s) 7
PfeI GAWTC 1 cut(s) 59
SetI ASST 6 cut(s) 77, 82, 91, 106, 130, 146
SgeI CNNG 8 cut(s) 18, 39, 60, 65, 119, 129, 133, 137
Sse9I AATT 4 cut(s) 21, 66, 96, 112
SspMI CTAG 2 cut(s) 6, 107
TasI AATT 4 cut(s) 21, 66, 96, 112
TfiI GAWTC 1 cut(s) 59
TspDTI ATGAA 1 cut(s) 141
XspI CTAG 2 cut(s) 6, 107
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.