RchiOBHm_Chr7g0220051

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0001143
Physical Location & Seq
Forward (+)
38837646 .. 38838363
718 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ19697

Sequence Viewer

Length: 189 bp
ATGGCTAGGGAGAAGAAAACTGCTCGACCTCGACCAGGTGCTTCTGGTCTTGAGGATTCTTCAACAGCCACATCACCGGCTTCTCCTCCACTGCTCGAAGCTGCAAGCCAACATGAAGTTGTAAGTGAACCTGCTGCAAGTCAACCTTCTGGAAATGTAGAAATGCAAAACAGTTGTAGCTTGCTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

6.36

Weight (kDa)

5.13

Isoelectric Point (pI)

69.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 139
AfiI CCNNNNNNNGG 1 cut(s) 35
AgsI TTSAA 1 cut(s) 63
AjnI CCWGG 1 cut(s) 34
AluBI AGCT 2 cut(s) 101, 180
AluI AGCT 2 cut(s) 101, 180
ApeKI GCWGC 2 cut(s) 101, 134
AsuHPI GGTGA 1 cut(s) 66
BbvI GCAGC 2 cut(s) 88, 121
BciT130I CCWGG 1 cut(s) 36
BfaI CTAG 1 cut(s) 6
BfuAI ACCTGC 1 cut(s) 139
BisI GCNGC 2 cut(s) 102, 135
BlsI GCNGC 2 cut(s) 103, 136
Bme1390I CCNGG 1 cut(s) 36
BmrFI CCNGG 1 cut(s) 36
BpuEI CTTGAG 1 cut(s) 71
Bsc4I CCNNNNNNNGG 1 cut(s) 35
Bse118I RCCGGY 1 cut(s) 76
BseBI CCWGG 1 cut(s) 36
BseLI CCNNNNNNNGG 1 cut(s) 35
BseRI GAGGAG 1 cut(s) 75
BseXI GCAGC 2 cut(s) 88, 121
BsiSI CCGG 1 cut(s) 77
BslI CCNNNNNNNGG 1 cut(s) 35
BspMI ACCTGC 1 cut(s) 139
BsrFI RCCGGY 1 cut(s) 76
BssAI RCCGGY 1 cut(s) 76
Bst2UI CCWGG 1 cut(s) 36
Bst4CI ACNGT 1 cut(s) 173
BstC8I GCNNGC 2 cut(s) 106, 182
BstENI CCTNNNNNAGG 1 cut(s) 33
BstNI CCWGG 1 cut(s) 36
BstSCI CCNGG 1 cut(s) 34
BstV1I GCAGC 2 cut(s) 88, 121
BtsI GCAGTG 1 cut(s) 89
BtsIMutI CAGTG 1 cut(s) 89
BveI ACCTGC 1 cut(s) 139
Cac8I GCNNGC 2 cut(s) 106, 182
Cfr10I RCCGGY 1 cut(s) 76
CsiI ACCWGGT 1 cut(s) 34
CviAII CATG 1 cut(s) 113
CviJI RGCY 6 cut(s) 5, 68, 80, 101, 108, 180
CviKI_1 RGCY 6 cut(s) 5, 68, 80, 101, 108, 180
EcoNI CCTNNNNNAGG 1 cut(s) 33
EcoRII CCWGG 1 cut(s) 34
FaeI CATG 1 cut(s) 116
FaiI YATR 1 cut(s) 114
FalI AAGNNNNNCTT 2 cut(s) 130, 162
FatI CATG 1 cut(s) 112
Fnu4HI GCNGC 2 cut(s) 102, 135
Fsp4HI GCNGC 2 cut(s) 102, 135
FspBI CTAG 1 cut(s) 6
GluI GCNGC 2 cut(s) 102, 135
HapII CCGG 1 cut(s) 77
Hin1II CATG 1 cut(s) 116
HincII GTYRAC 1 cut(s) 143
HindII GTYRAC 1 cut(s) 143
HinfI GANTC 1 cut(s) 56
HpaII CCGG 1 cut(s) 77
HphI GGTGA 1 cut(s) 66
Hpy166II GTNNAC 2 cut(s) 128, 143
Hpy188III TCNNGA 2 cut(s) 50, 150
Hpy8I GTNNAC 2 cut(s) 128, 143
HpyAV CCTTC 1 cut(s) 156
HpyCH4III ACNGT 1 cut(s) 173
HpyCH4V TGCA 3 cut(s) 104, 137, 166
Hsp92II CATG 1 cut(s) 116
LpnPI CCDG 6 cut(s) 21, 30, 48, 90, 135, 144
Lsp1109I GCAGC 2 cut(s) 88, 121
MabI ACCWGGT 1 cut(s) 34
MaeI CTAG 1 cut(s) 6
MboII GAAGA 2 cut(s) 25, 51
MnlI CCTC 3 cut(s) 39, 46, 96
MseI TTAA 1 cut(s) 187
MspI CCGG 1 cut(s) 77
MspR9I CCNGG 1 cut(s) 36
MvaI CCWGG 1 cut(s) 36
NlaIII CATG 1 cut(s) 116
PfeI GAWTC 1 cut(s) 56
PkrI GCNGC 2 cut(s) 103, 136
Psp6I CCWGG 1 cut(s) 34
PspGI CCWGG 1 cut(s) 34
SaqAI TTAA 1 cut(s) 187
SatI GCNGC 2 cut(s) 102, 135
ScrFI CCNGG 1 cut(s) 36
SetI ASST 6 cut(s) 31, 40, 103, 133, 148, 182
SexAI ACCWGGT 1 cut(s) 34
SmlI CTYRAG 1 cut(s) 50
SmoI CTYRAG 1 cut(s) 50
SspMI CTAG 1 cut(s) 6
StyD4I CCNGG 1 cut(s) 34
TaaI ACNGT 1 cut(s) 173
TaqI TCGA 3 cut(s) 25, 31, 96
TfiI GAWTC 1 cut(s) 56
Tru1I TTAA 1 cut(s) 187
Tru9I TTAA 1 cut(s) 187
TscAI CASTG 1 cut(s) 96
TseI GCWGC 2 cut(s) 101, 134
TspDTI ATGAA 1 cut(s) 129
TspRI CASTG 1 cut(s) 96
XagI CCTNNNNNAGG 1 cut(s) 33
XspI CTAG 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.