Rmu_sc0009431.1_g000007

Zinc finger BED domain-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0009431.1
OG0001143
Physical Location & Seq
Forward (+)
34744 .. 35205
462 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0009431.1_g000007.1.cds

Sequence Viewer

Length: 462 bp
atggctagagcgaaaaaaatagctcgacctcgatcaaatgcttctagtcttgaggattcttcaacagccacatcaccagcttttcctacacagctcgatgctacaagccaacccaaagctgcaaatcgcccaaatccaactcttgaagtaggtcaagtagctgcaagtcaaccttttggaagcgaagctgctgcatctgtaggtgaggctccttctgaaaaatcaggtataaaacgtagctttgtttgggatcattttaaagagtatgataagattgaacatggtaaagatgctgatggaaaagacattcagatagttcataagagagctcattgcatctactgtcctaggggaaaggttggtgattttgctgttgacagttctaagaatggcacttatggtatgattaggcacattaacatgaattgtagctattatcctcctaatatggataagtcgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4413 Dimer_Tnp_hAT zf-BED

Protein Analysis

153

Amino Acids

16.63

Weight (kDa)

8.97

Isoelectric Point (pI)

43.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 258
AgsI TTSAA 3 cut(s) 63, 146, 278
AluBI AGCT 9 cut(s) 23, 80, 94, 119, 161, 188, 240, 329, 432
AluI AGCT 9 cut(s) 23, 80, 94, 119, 161, 188, 240, 329, 432
Alw21I GWGCWC 1 cut(s) 331
AlwI GGATC 1 cut(s) 258
ApeKI GCWGC 4 cut(s) 119, 161, 188, 191
AspA2I CCTAGG 1 cut(s) 347
AsuHPI GGTGA 3 cut(s) 66, 215, 374
AvrII CCTAGG 1 cut(s) 347
BanII GRGCYC 1 cut(s) 331
Bbv12I GWGCWC 1 cut(s) 331
BbvI GCAGC 4 cut(s) 106, 148, 175, 178
BccI CCATC 1 cut(s) 290
BcgI CGANNNNNNTGC 2 cut(s) 173, 207
BfaI CTAG 3 cut(s) 6, 45, 348
BfmI CTRYAG 1 cut(s) 198
BisI GCNGC 4 cut(s) 120, 162, 189, 192
BlnI CCTAGG 1 cut(s) 347
BlsI GCNGC 4 cut(s) 121, 163, 190, 193
BmiI GGNNCC 1 cut(s) 210
BmsI GCATC 4 cut(s) 88, 203, 280, 345
BpuEI CTTGAG 1 cut(s) 71
BsaJI CCNNGG 1 cut(s) 347
Bse3DI GCAATG 1 cut(s) 331
BseDI CCNNGG 1 cut(s) 347
BseMI GCAATG 1 cut(s) 331
BseXI GCAGC 4 cut(s) 106, 148, 175, 178
BsiHKAI GWGCWC 1 cut(s) 331
Bsp1286I GDGCHC 1 cut(s) 331
Bsp143I GATC 2 cut(s) 32, 250
BspLI GGNNCC 1 cut(s) 210
BspPI GGATC 1 cut(s) 258
BsrDI GCAATG 1 cut(s) 331
BssECI CCNNGG 1 cut(s) 347
BssMI GATC 2 cut(s) 32, 250
BssT1I CCWWGG 1 cut(s) 347
Bst4CI ACNGT 2 cut(s) 344, 380
BstDEI CTNAG 1 cut(s) 384
BstKTI GATC 2 cut(s) 35, 253
BstMBI GATC 2 cut(s) 32, 250
BstSFI CTRYAG 1 cut(s) 198
BstV1I GCAGC 4 cut(s) 106, 148, 175, 178
CviAII CATG 2 cut(s) 281, 421
DdeI CTNAG 1 cut(s) 384
DpnI GATC 2 cut(s) 34, 252
DpnII GATC 2 cut(s) 32, 250
DraI TTTAAA 1 cut(s) 259
Ecl136II GAGCTC 1 cut(s) 329
Eco130I CCWWGG 1 cut(s) 347
Eco24I GRGCYC 1 cut(s) 331
Eco53kI GAGCTC 1 cut(s) 329
EcoICRI GAGCTC 1 cut(s) 329
EcoT14I CCWWGG 1 cut(s) 347
EcoT38I GRGCYC 1 cut(s) 331
ErhI CCWWGG 1 cut(s) 347
FaeI CATG 2 cut(s) 284, 424
FaiI YATR 8 cut(s) 230, 267, 282, 321, 399, 404, 422, 449
FalI AAGNNNNNCTT 2 cut(s) 157, 189
FatI CATG 2 cut(s) 280, 420
Fnu4HI GCNGC 4 cut(s) 120, 162, 189, 192
FriOI GRGCYC 1 cut(s) 331
Fsp4HI GCNGC 4 cut(s) 120, 162, 189, 192
FspBI CTAG 3 cut(s) 6, 45, 348
GluI GCNGC 4 cut(s) 120, 162, 189, 192
Hin1II CATG 2 cut(s) 284, 424
HincII GTYRAC 2 cut(s) 170, 376
HindII GTYRAC 2 cut(s) 170, 376
HinfI GANTC 1 cut(s) 56
HphI GGTGA 3 cut(s) 66, 215, 374
Hpy166II GTNNAC 2 cut(s) 170, 376
Hpy188I TCNGA 2 cut(s) 217, 312
Hpy188III TCNNGA 2 cut(s) 50, 143
Hpy8I GTNNAC 2 cut(s) 170, 376
HpyAV CCTTC 1 cut(s) 222
HpyCH4III ACNGT 2 cut(s) 344, 380
HpyCH4IV ACGT 1 cut(s) 235
HpyCH4V TGCA 4 cut(s) 122, 164, 194, 336
HpyF3I CTNAG 1 cut(s) 384
HpySE526I ACGT 1 cut(s) 235
Hsp92II CATG 2 cut(s) 284, 424
Kzo9I GATC 2 cut(s) 32, 250
LmnI GCTCC 1 cut(s) 214
LpnPI CCDG 2 cut(s) 90, 210
Lsp1109I GCAGC 4 cut(s) 106, 148, 175, 178
LweI GCATC 4 cut(s) 88, 203, 280, 345
MaeI CTAG 3 cut(s) 6, 45, 348
MaeII ACGT 1 cut(s) 235
MalI GATC 2 cut(s) 34, 252
MboI GATC 2 cut(s) 32, 250
MboII GAAGA 1 cut(s) 51
MhlI GDGCHC 1 cut(s) 331
MluCI AATT 1 cut(s) 424
MmeI TCCRAC 1 cut(s) 161
MnlI CCTC 4 cut(s) 39, 46, 199, 450
MseI TTAA 2 cut(s) 258, 417
MslI CAYNNNNRTG 1 cut(s) 419
NdeII GATC 2 cut(s) 32, 250
NlaIII CATG 2 cut(s) 284, 424
NlaIV GGNNCC 1 cut(s) 210
PfeI GAWTC 1 cut(s) 56
PkrI GCNGC 4 cut(s) 121, 163, 190, 193
Psp124BI GAGCTC 1 cut(s) 331
PspN4I GGNNCC 1 cut(s) 210
RseI CAYNNNNRTG 1 cut(s) 419
SacI GAGCTC 1 cut(s) 331
SaqAI TTAA 2 cut(s) 258, 417
SatI GCNGC 4 cut(s) 120, 162, 189, 192
Sau3AI GATC 2 cut(s) 32, 250
SduI GDGCHC 1 cut(s) 331
SfaNI GCATC 4 cut(s) 88, 203, 280, 345
SfcI CTRYAG 1 cut(s) 198
SmiMI CAYNNNNRTG 1 cut(s) 419
SmlI CTYRAG 1 cut(s) 50
SmoI CTYRAG 1 cut(s) 50
Sse9I AATT 1 cut(s) 424
SspMI CTAG 3 cut(s) 6, 45, 348
SstI GAGCTC 1 cut(s) 331
StyI CCWWGG 1 cut(s) 347
TaaI ACNGT 2 cut(s) 344, 380
TaiI ACGT 1 cut(s) 238
TaqI TCGA 3 cut(s) 25, 31, 96
TasI AATT 1 cut(s) 424
TfiI GAWTC 1 cut(s) 56
Tru1I TTAA 2 cut(s) 258, 417
Tru9I TTAA 2 cut(s) 258, 417
TseI GCWGC 4 cut(s) 119, 161, 188, 191
TspDTI ATGAA 2 cut(s) 308, 437
XmaJI CCTAGG 1 cut(s) 347
XspI CTAG 3 cut(s) 6, 45, 348
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.