pycom08g17470

Ras-related protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr8
Physical Location & Seq
Forward (+)
17656392 .. 17659787
3396 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom08g17470.1

Sequence Viewer

Length: 231 bp
ATGTTGTTGTGGAGATCGGAGAGGAGAGAGGGCGGCATGGCGAGTAGAGTAGACCACGAATACGACTACCTGTTCAAGATCGTGTTGATCGGTGACTCTGGTGTGGGCAAATCTAACATTCTCTCTAGATTTATCAGGAATGAGTTCTGCTTGGAGTCCAAATCCACTATCGGAGTCGAGTTCGCCACCGAACTCTCCAGGCAACTATATGAATGTGGTTTTGCCAGATAA

Protein Analysis

77

Amino Acids

8.78

Weight (kDa)

6.56

Isoelectric Point (pI)

61.78

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ras PF00071 26 - 64 4.5e-11 Ras family
Roc PF08477 26 - 64 1.4e-10 Ras of Complex, Roc, domain of DAPkinase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 51
AciI CCGC 1 cut(s) 33
AgsI TTSAA 1 cut(s) 76
AjnI CCWGG 1 cut(s) 197
Asp700I GAANNNNTTC 1 cut(s) 143
AsuHPI GGTGA 1 cut(s) 104
BciT130I CCWGG 1 cut(s) 199
BfaI CTAG 1 cut(s) 126
BisI GCNGC 1 cut(s) 34
BlsI GCNGC 1 cut(s) 35
Bme1390I CCNGG 1 cut(s) 199
BmrFI CCNGG 1 cut(s) 199
BpmI CTGGAG 1 cut(s) 181
BseBI CCWGG 1 cut(s) 199
BseRI GAGGAG 1 cut(s) 37
Bsp143I GATC 3 cut(s) 14, 78, 87
BspACI CCGC 1 cut(s) 33
BssMI GATC 3 cut(s) 14, 78, 87
Bst2UI CCWGG 1 cut(s) 199
BstKTI GATC 3 cut(s) 17, 81, 90
BstMBI GATC 3 cut(s) 14, 78, 87
BstNI CCWGG 1 cut(s) 199
BstSCI CCNGG 1 cut(s) 197
CviAII CATG 1 cut(s) 37
DpnI GATC 3 cut(s) 16, 80, 89
DpnII GATC 3 cut(s) 14, 78, 87
EcoRII CCWGG 1 cut(s) 197
FaeI CATG 1 cut(s) 40
FaiI YATR 3 cut(s) 38, 208, 210
FatI CATG 1 cut(s) 36
FblI GTMKAC 1 cut(s) 51
Fnu4HI GCNGC 1 cut(s) 34
Fsp4HI GCNGC 1 cut(s) 34
FspBI CTAG 1 cut(s) 126
GluI GCNGC 1 cut(s) 34
GsuI CTGGAG 1 cut(s) 181
Hin1II CATG 1 cut(s) 40
HinfI GANTC 3 cut(s) 95, 155, 174
HphI GGTGA 1 cut(s) 104
Hpy166II GTNNAC 1 cut(s) 52
Hpy188I TCNGA 2 cut(s) 19, 173
Hpy188III TCNNGA 3 cut(s) 76, 126, 136
Hpy8I GTNNAC 1 cut(s) 52
Hsp92II CATG 1 cut(s) 40
Kzo9I GATC 3 cut(s) 14, 78, 87
LpnPI CCDG 5 cut(s) 83, 84, 121, 184, 211
MaeI CTAG 1 cut(s) 126
MaeIII GTNAC 1 cut(s) 92
MalI GATC 3 cut(s) 16, 80, 89
MboI GATC 3 cut(s) 14, 78, 87
MlyI GAGTC 3 cut(s) 89, 164, 183
MnlI CCTC 2 cut(s) 15, 22
MroXI GAANNNNTTC 1 cut(s) 143
MspR9I CCNGG 1 cut(s) 199
MvaI CCWGG 1 cut(s) 199
NdeII GATC 3 cut(s) 14, 78, 87
NlaIII CATG 1 cut(s) 40
NmuCI GTSAC 1 cut(s) 92
PdmI GAANNNNTTC 1 cut(s) 143
PkrI GCNGC 1 cut(s) 35
PleI GAGTC 3 cut(s) 89, 163, 182
PpsI GAGTC 3 cut(s) 89, 163, 182
Psp6I CCWGG 1 cut(s) 197
PspGI CCWGG 1 cut(s) 197
SatI GCNGC 1 cut(s) 34
Sau3AI GATC 3 cut(s) 14, 78, 87
SchI GAGTC 3 cut(s) 89, 164, 183
ScrFI CCNGG 1 cut(s) 199
SetI ASST 1 cut(s) 72
SsiI CCGC 1 cut(s) 33
SspMI CTAG 1 cut(s) 126
StyD4I CCNGG 1 cut(s) 197
TaqI TCGA 1 cut(s) 177
TauI GCSGC 1 cut(s) 36
TseFI GTSAC 1 cut(s) 92
Tsp45I GTSAC 1 cut(s) 92
TspDTI ATGAA 1 cut(s) 225
XbaI TCTAGA 1 cut(s) 125
XmiI GTMKAC 1 cut(s) 51
XmnI GAANNNNTTC 1 cut(s) 143
XspI CTAG 1 cut(s) 126
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.