Rh5CG021900

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
OG0001046
Physical Location & Seq
Forward (+)
1411006 .. 1422617
11612 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG021900.1

Sequence Viewer

Length: 288 bp
ATGTATTTTAACCAGGTCAAGTGGATTGAGCCAGATGTAGCAAAGGGAAAAGTAGTAGCTGCTGAAAGTGATGAAGAAGAACCAACTGCCAAAGCTGGAACCTCAAGCTCAAAGCCTGCACAAGTCTCCAAAAGAGCTGCAGCTGCAACTCCTTCAACAAGTGCCGCTGCTGGGACCTCAAAATCTACAAAACCACCAAAACAAGGGCTGCTGCCACCAAGAAAAGCTAAAGTTCAAATTTCATTAGCTACCATAAAAGACAATCCACATGAAAATTTCTACAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

95

Amino Acids

10.07

Weight (kDa)

9.7

Isoelectric Point (pI)

39.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 165
AcsI RAATTY 2 cut(s) 237, 274
AfiI CCNNNNNNNGG 2 cut(s) 171, 203
AgsI TTSAA 2 cut(s) 156, 236
AjnI CCWGG 1 cut(s) 12
AluBI AGCT 7 cut(s) 59, 95, 108, 137, 143, 227, 248
AluI AGCT 7 cut(s) 59, 95, 108, 137, 143, 227, 248
Alw26I GTCTC 1 cut(s) 130
ApeKI GCWGC 7 cut(s) 59, 137, 140, 143, 167, 208, 211
ApoI RAATTY 2 cut(s) 237, 274
AspS9I GGNCC 1 cut(s) 174
AvaII GGWCC 1 cut(s) 174
BbvI GCAGC 7 cut(s) 46, 124, 130, 152, 154, 195, 198
BciT130I CCWGG 1 cut(s) 14
BcoDI GTCTC 1 cut(s) 130
BfmI CTRYAG 1 cut(s) 138
BisI GCNGC 8 cut(s) 60, 138, 141, 144, 165, 168, 209, 212
BlsI GCNGC 8 cut(s) 61, 139, 142, 145, 166, 169, 210, 213
Bme1390I CCNGG 1 cut(s) 14
Bme18I GGWCC 1 cut(s) 174
BmgT120I GGNCC 1 cut(s) 174
BmiI GGNNCC 2 cut(s) 100, 175
BmrFI CCNGG 1 cut(s) 14
BpuEI CTTGAG 1 cut(s) 88
Bsc4I CCNNNNNNNGG 2 cut(s) 171, 203
BseBI CCWGG 1 cut(s) 14
BseLI CCNNNNNNNGG 2 cut(s) 171, 203
BseXI GCAGC 7 cut(s) 46, 124, 130, 152, 154, 195, 198
BseYI CCCAGC 1 cut(s) 170
BsgI GTGCAG 1 cut(s) 102
BslFI GGGAC 1 cut(s) 187
BslI CCNNNNNNNGG 2 cut(s) 171, 203
BsmAI GTCTC 1 cut(s) 130
BsmFI GGGAC 1 cut(s) 187
BspACI CCGC 1 cut(s) 165
BspLI GGNNCC 2 cut(s) 100, 175
BspMAI CTGCAG 1 cut(s) 142
Bst2UI CCWGG 1 cut(s) 14
BstC8I GCNNGC 1 cut(s) 117
BstMAI GTCTC 1 cut(s) 130
BstMWI GCNNNNNNNGC 1 cut(s) 143
BstNI CCWGG 1 cut(s) 14
BstSCI CCNGG 1 cut(s) 12
BstSFI CTRYAG 1 cut(s) 138
BstV1I GCAGC 7 cut(s) 46, 124, 130, 152, 154, 195, 198
Cac8I GCNNGC 1 cut(s) 117
Cfr13I GGNCC 1 cut(s) 174
CsiI ACCWGGT 1 cut(s) 12
CviAII CATG 1 cut(s) 269
Eco47I GGWCC 1 cut(s) 174
EcoO109I RGGNCCY 1 cut(s) 174
EcoRII CCWGG 1 cut(s) 12
FaeI CATG 1 cut(s) 272
FaiI YATR 2 cut(s) 254, 270
FaqI GGGAC 1 cut(s) 187
FatI CATG 1 cut(s) 268
Fnu4HI GCNGC 8 cut(s) 60, 138, 141, 144, 165, 168, 209, 212
Fsp4HI GCNGC 8 cut(s) 60, 138, 141, 144, 165, 168, 209, 212
GluI GCNGC 8 cut(s) 60, 138, 141, 144, 165, 168, 209, 212
GsaI CCCAGC 1 cut(s) 174
Hin1II CATG 1 cut(s) 272
HpyAV CCTTC 1 cut(s) 162
HpyCH4V TGCA 3 cut(s) 119, 140, 146
HpyF10VI GCNNNNNNNGC 1 cut(s) 143
Hsp92II CATG 1 cut(s) 272
LpnPI CCDG 5 cut(s) 26, 45, 81, 129, 156
Lsp1109I GCAGC 7 cut(s) 46, 124, 130, 152, 154, 195, 198
MabI ACCWGGT 1 cut(s) 12
MboII GAAGA 2 cut(s) 86, 89
MluCI AATT 2 cut(s) 237, 274
MnlI CCTC 2 cut(s) 112, 187
MseI TTAA 1 cut(s) 9
MspA1I CMGCKG 2 cut(s) 143, 167
MspR9I CCNGG 1 cut(s) 14
MvaI CCWGG 1 cut(s) 14
MwoI GCNNNNNNNGC 1 cut(s) 143
NlaIII CATG 1 cut(s) 272
NlaIV GGNNCC 2 cut(s) 100, 175
PkrI GCNGC 8 cut(s) 61, 139, 142, 145, 166, 169, 210, 213
PpuMI RGGWCCY 1 cut(s) 174
Psp5II RGGWCCY 1 cut(s) 174
Psp6I CCWGG 1 cut(s) 12
PspFI CCCAGC 1 cut(s) 170
PspGI CCWGG 1 cut(s) 12
PspN4I GGNNCC 2 cut(s) 100, 175
PspPI GGNCC 1 cut(s) 174
PspPPI RGGWCCY 1 cut(s) 174
PstI CTGCAG 1 cut(s) 142
PvuII CAGCTG 1 cut(s) 143
SaqAI TTAA 1 cut(s) 9
SatI GCNGC 8 cut(s) 60, 138, 141, 144, 165, 168, 209, 212
Sau96I GGNCC 1 cut(s) 174
ScrFI CCNGG 1 cut(s) 14
SexAI ACCWGGT 1 cut(s) 12
SfcI CTRYAG 1 cut(s) 138
SinI GGWCC 1 cut(s) 174
SmlI CTYRAG 1 cut(s) 103
SmoI CTYRAG 1 cut(s) 103
Sse9I AATT 2 cut(s) 237, 274
SsiI CCGC 1 cut(s) 165
StyD4I CCNGG 1 cut(s) 12
TasI AATT 2 cut(s) 237, 274
TauI GCSGC 1 cut(s) 167
Tru1I TTAA 1 cut(s) 9
Tru9I TTAA 1 cut(s) 9
TseI GCWGC 7 cut(s) 59, 137, 140, 143, 167, 208, 211
TspDTI ATGAA 3 cut(s) 87, 231, 285
VpaK11BI GGWCC 1 cut(s) 174
XapI RAATTY 2 cut(s) 237, 274
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.