Rh6CG444300

Ras-related protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
OG0001046
Physical Location & Seq
Reverse (-)
62272832 .. 62273083
252 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG444300.1

Sequence Viewer

Length: 252 bp
ATGAGCACTGATTCTCCGGCGACGACGACAAGGCCCTCGGCCTCTTCATCTCCAACCGGAAAGTCTCTCCGGCTCTTTGACATGGCCTACAGGTTGGATGACGACTACCACTTCAAGGTCGTCTTGATCGACCATTCCGGCATCGGCAAATCTGATTTGTTGTCCAGGTTCATGCGCAACGAGTTCAACCTCGAGTCTAAGTCCACCATCGGTGTCGAGTTTGTCACCCGGAGCATCCACTTCGATGATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005623 GO:0005886 GO:0016020 GO:0044464 GO:0071944
KEGG Pathways
Metabolic & Signaling
ko04144 ko04961 ko04962 ko04972 map04144 map04961 map04962 map04972
Pfam Domains
Protein Families
Ras

Protein Analysis

83

Amino Acids

9.35

Weight (kDa)

5.83

Isoelectric Point (pI)

47.47

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ras PF00071 39 - 82 7.1e-10 Ras family
Roc PF08477 39 - 79 3e-08 Ras of Complex, Roc, domain of DAPkinase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 176
AfiI CCNNNNNNNGG 1 cut(s) 115
AgsI TTSAA 2 cut(s) 115, 187
AjnI CCWGG 1 cut(s) 164
Alw21I GWGCWC 1 cut(s) 8
Alw26I GTCTC 1 cut(s) 69
Ama87I CYCGRG 1 cut(s) 191
AoxI GGCC 3 cut(s) 32, 39, 84
AspLEI GCGC 1 cut(s) 177
AspS9I GGNCC 1 cut(s) 33
AsuC2I CCSGG 1 cut(s) 229
AsuHPI GGTGA 1 cut(s) 217
AvaI CYCGRG 1 cut(s) 191
Bbv12I GWGCWC 1 cut(s) 8
BccI CCATC 1 cut(s) 215
BcgI CGANNNNNNTGC 1 cut(s) 223
BciT130I CCWGG 1 cut(s) 166
BcnI CCSGG 1 cut(s) 229
BcoDI GTCTC 1 cut(s) 69
BfmI CTRYAG 1 cut(s) 88
Bme1390I CCNGG 2 cut(s) 166, 229
BmeT110I CYCGRG 1 cut(s) 191
BmgT120I GGNCC 1 cut(s) 33
BmrFI CCNGG 2 cut(s) 166, 229
BmsI GCATC 2 cut(s) 150, 243
BpuMI CCSGG 1 cut(s) 229
BsaJI CCNNGG 1 cut(s) 36
BsaWI WCCGGW 1 cut(s) 56
BsaXI ACNNNNNCTCC 1 cut(s) 28
Bsc4I CCNNNNNNNGG 1 cut(s) 115
BseBI CCWGG 1 cut(s) 166
BseDI CCNNGG 1 cut(s) 36
BseGI GGATG 2 cut(s) 103, 234
BseLI CCNNNNNNNGG 1 cut(s) 115
BshFI GGCC 3 cut(s) 34, 41, 86
BsiHKAI GWGCWC 1 cut(s) 8
BsiHKCI CYCGRG 1 cut(s) 191
BsiSI CCGG 5 cut(s) 17, 57, 70, 138, 229
BslI CCNNNNNNNGG 1 cut(s) 115
BsmAI GTCTC 1 cut(s) 69
BsnI GGCC 3 cut(s) 34, 41, 86
BsoBI CYCGRG 1 cut(s) 191
Bsp1286I GDGCHC 1 cut(s) 8
Bsp143I GATC 1 cut(s) 126
BspANI GGCC 3 cut(s) 34, 41, 86
BssECI CCNNGG 1 cut(s) 36
BssMI GATC 1 cut(s) 126
Bst2UI CCWGG 1 cut(s) 166
Bst6I CTCTTC 1 cut(s) 49
BstDEI CTNAG 1 cut(s) 198
BstF5I GGATG 2 cut(s) 103, 234
BstHHI GCGC 1 cut(s) 177
BstKTI GATC 1 cut(s) 129
BstMAI GTCTC 1 cut(s) 69
BstMBI GATC 1 cut(s) 126
BstNI CCWGG 1 cut(s) 166
BstSCI CCNGG 2 cut(s) 164, 227
BstSFI CTRYAG 1 cut(s) 88
BsuRI GGCC 3 cut(s) 34, 41, 86
BtsCI GGATG 2 cut(s) 103, 234
BtsIMutI CAGTG 1 cut(s) 6
CfoI GCGC 1 cut(s) 177
Cfr13I GGNCC 1 cut(s) 33
CviAII CATG 2 cut(s) 82, 172
CviJI RGCY 4 cut(s) 34, 41, 73, 86
CviKI_1 RGCY 4 cut(s) 34, 41, 73, 86
DdeI CTNAG 1 cut(s) 198
DpnI GATC 1 cut(s) 128
DpnII GATC 1 cut(s) 126
Eam1104I CTCTTC 1 cut(s) 49
EarI CTCTTC 1 cut(s) 49
Eco88I CYCGRG 1 cut(s) 191
EcoO109I RGGNCCY 1 cut(s) 33
EcoRII CCWGG 1 cut(s) 164
FaeI CATG 2 cut(s) 85, 175
FaiI YATR 2 cut(s) 83, 173
FalI AAGNNNNNCTT 2 cut(s) 107, 139
FatI CATG 2 cut(s) 81, 171
FokI GGATG 2 cut(s) 110, 221
FspI TGCGCA 1 cut(s) 176
GlaI GCGC 1 cut(s) 176
HaeIII GGCC 3 cut(s) 34, 41, 86
HapII CCGG 5 cut(s) 17, 57, 70, 138, 229
HhaI GCGC 1 cut(s) 177
Hin1II CATG 2 cut(s) 85, 175
Hin6I GCGC 1 cut(s) 175
HinP1I GCGC 1 cut(s) 175
HinfI GANTC 2 cut(s) 11, 194
HpaII CCGG 5 cut(s) 17, 57, 70, 138, 229
HphI GGTGA 1 cut(s) 217
Hpy166II GTNNAC 1 cut(s) 204
Hpy188I TCNGA 1 cut(s) 154
Hpy188III TCNNGA 1 cut(s) 124
Hpy8I GTNNAC 1 cut(s) 204
Hpy99I CGWCG 2 cut(s) 25, 28
HpyF3I CTNAG 1 cut(s) 198
Hsp92II CATG 2 cut(s) 85, 175
HspAI GCGC 1 cut(s) 175
Kzo9I GATC 1 cut(s) 126
LmnI GCTCC 1 cut(s) 231
LpnPI CCDG 8 cut(s) 30, 70, 76, 83, 151, 151, 178, 242
LweI GCATC 2 cut(s) 150, 243
MaeIII GTNAC 1 cut(s) 223
MalI GATC 1 cut(s) 128
MboI GATC 1 cut(s) 126
MboII GAAGA 1 cut(s) 36
MhlI GDGCHC 1 cut(s) 8
MlyI GAGTC 1 cut(s) 203
MmeI TCCRAC 2 cut(s) 75, 77
MnlI CCTC 3 cut(s) 46, 52, 200
MslI CAYNNNNRTG 1 cut(s) 243
MspI CCGG 5 cut(s) 17, 57, 70, 138, 229
MspR9I CCNGG 2 cut(s) 166, 229
MvaI CCWGG 1 cut(s) 166
NciI CCSGG 1 cut(s) 229
NdeII GATC 1 cut(s) 126
NlaIII CATG 2 cut(s) 85, 175
NmeAIII GCCGAG 1 cut(s) 17
NmuCI GTSAC 1 cut(s) 223
NsbI TGCGCA 1 cut(s) 176
PaeR7I CTCGAG 1 cut(s) 191
PcsI WCGNNNNNNNCGW 1 cut(s) 126
PfeI GAWTC 1 cut(s) 11
PleI GAGTC 1 cut(s) 202
PpsI GAGTC 1 cut(s) 202
Psp6I CCWGG 1 cut(s) 164
PspGI CCWGG 1 cut(s) 164
PspPI GGNCC 1 cut(s) 33
PspXI VCTCGAGB 1 cut(s) 191
RseI CAYNNNNRTG 1 cut(s) 243
Sau3AI GATC 1 cut(s) 126
Sau96I GGNCC 1 cut(s) 33
SchI GAGTC 1 cut(s) 203
ScrFI CCNGG 2 cut(s) 166, 229
SduI GDGCHC 1 cut(s) 8
SetI ASST 4 cut(s) 95, 120, 170, 192
SfaNI GCATC 2 cut(s) 150, 243
SfcI CTRYAG 1 cut(s) 88
Sfr274I CTCGAG 1 cut(s) 191
SlaI CTCGAG 1 cut(s) 191
SmiMI CAYNNNNRTG 1 cut(s) 243
SmlI CTYRAG 1 cut(s) 191
SmoI CTYRAG 1 cut(s) 191
StyD4I CCNGG 2 cut(s) 164, 227
TaqI TCGA 4 cut(s) 129, 192, 216, 243
TfiI GAWTC 1 cut(s) 11
TscAI CASTG 1 cut(s) 13
TseFI GTSAC 1 cut(s) 223
Tsp45I GTSAC 1 cut(s) 223
TspDTI ATGAA 2 cut(s) 36, 160
TspRI CASTG 1 cut(s) 13
XhoI CTCGAG 1 cut(s) 191
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.