Rmu_sc0002117.1_g000012

Ras-related protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002117.1
OG0001046
Physical Location & Seq
Forward (+)
61947 .. 62195
249 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002117.1_g000012.1.cds

Sequence Viewer

Length: 249 bp
atgagcaatgattctccggcgacgatgacaaggcccacggcctcttcatgtccaaccggaaagtctctccagctcttcgacatgggtaggtcagacaacgactaccacttgaaggtcgtcttgatcggccattccggtatcggcaaatccgattttttgtccaagttcataggcaatgagttcaacctcgagtctaagtccactatcggtgtcgagtttgccacccggagcatccacgtcgatgattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005623 GO:0005886 GO:0016020 GO:0044464 GO:0071944
KEGG Pathways
Metabolic & Signaling
ko04144 ko04961 ko04962 ko04972 map04144 map04961 map04962 map04972
Pfam Domains
Protein Families
Ras

Protein Analysis

82

Amino Acids

8.91

Weight (kDa)

5.82

Isoelectric Point (pI)

47.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 127
AfiI CCNNNNNNNGG 1 cut(s) 112
AgsI TTSAA 2 cut(s) 112, 184
AjiI CACGTC 1 cut(s) 238
AluBI AGCT 1 cut(s) 73
AluI AGCT 1 cut(s) 73
Alw26I GTCTC 1 cut(s) 69
Ama87I CYCGRG 1 cut(s) 188
AoxI GGCC 3 cut(s) 32, 39, 127
AspS9I GGNCC 1 cut(s) 33
AsuC2I CCSGG 1 cut(s) 226
AvaI CYCGRG 1 cut(s) 188
BceAI ACGGC 1 cut(s) 54
BcgI CGANNNNNNTGC 1 cut(s) 220
BcnI CCSGG 1 cut(s) 226
BcoDI GTCTC 1 cut(s) 69
Bme1390I CCNGG 1 cut(s) 226
BmeT110I CYCGRG 1 cut(s) 188
BmgBI CACGTC 1 cut(s) 238
BmgT120I GGNCC 1 cut(s) 33
BmrFI CCNGG 1 cut(s) 226
BmsI GCATC 1 cut(s) 240
BpmI CTGGAG 1 cut(s) 53
BpuMI CCSGG 1 cut(s) 226
BsaJI CCNNGG 1 cut(s) 36
BsaWI WCCGGW 2 cut(s) 56, 134
Bsc4I CCNNNNNNNGG 1 cut(s) 112
Bse3DI GCAATG 2 cut(s) 13, 181
BseDI CCNNGG 1 cut(s) 36
BseGI GGATG 1 cut(s) 231
BseLI CCNNNNNNNGG 1 cut(s) 112
BseMI GCAATG 2 cut(s) 13, 181
BshFI GGCC 3 cut(s) 34, 41, 129
BsiHKCI CYCGRG 1 cut(s) 188
BsiSI CCGG 4 cut(s) 17, 57, 135, 226
BslI CCNNNNNNNGG 1 cut(s) 112
BsmAI GTCTC 1 cut(s) 69
BsnI GGCC 3 cut(s) 34, 41, 129
BsoBI CYCGRG 1 cut(s) 188
Bsp143I GATC 1 cut(s) 123
BspANI GGCC 3 cut(s) 34, 41, 129
BspQI GCTCTTC 1 cut(s) 80
BsrDI GCAATG 2 cut(s) 13, 181
BssECI CCNNGG 1 cut(s) 36
BssMI GATC 1 cut(s) 123
Bst6I CTCTTC 2 cut(s) 49, 80
BstDEI CTNAG 1 cut(s) 195
BstDSI CCRYGG 1 cut(s) 36
BstF5I GGATG 1 cut(s) 231
BstKTI GATC 1 cut(s) 126
BstMAI GTCTC 1 cut(s) 69
BstMBI GATC 1 cut(s) 123
BstSCI CCNGG 1 cut(s) 224
BsuRI GGCC 3 cut(s) 34, 41, 129
BtgI CCRYGG 1 cut(s) 36
BtrI CACGTC 1 cut(s) 238
BtsCI GGATG 1 cut(s) 231
Cfr13I GGNCC 1 cut(s) 33
CviAII CATG 2 cut(s) 48, 82
CviJI RGCY 4 cut(s) 34, 41, 73, 129
CviKI_1 RGCY 4 cut(s) 34, 41, 73, 129
DdeI CTNAG 1 cut(s) 195
DpnI GATC 1 cut(s) 125
DpnII GATC 1 cut(s) 123
EaeI YGGCCR 1 cut(s) 127
Eam1104I CTCTTC 2 cut(s) 49, 80
EarI CTCTTC 2 cut(s) 49, 80
Eco88I CYCGRG 1 cut(s) 188
FaeI CATG 2 cut(s) 51, 85
FaiI YATR 3 cut(s) 49, 83, 170
FalI AAGNNNNNCTT 2 cut(s) 104, 136
FatI CATG 2 cut(s) 47, 81
FokI GGATG 1 cut(s) 218
GsuI CTGGAG 1 cut(s) 53
HaeIII GGCC 3 cut(s) 34, 41, 129
HapII CCGG 4 cut(s) 17, 57, 135, 226
Hin1II CATG 2 cut(s) 51, 85
HinfI GANTC 2 cut(s) 11, 191
HpaII CCGG 4 cut(s) 17, 57, 135, 226
Hpy166II GTNNAC 1 cut(s) 201
Hpy188I TCNGA 2 cut(s) 94, 151
Hpy188III TCNNGA 1 cut(s) 121
Hpy8I GTNNAC 1 cut(s) 201
Hpy99I CGWCG 2 cut(s) 25, 242
HpyAV CCTTC 1 cut(s) 106
HpyCH4IV ACGT 1 cut(s) 237
HpyF3I CTNAG 1 cut(s) 195
HpySE526I ACGT 1 cut(s) 237
Hsp92II CATG 2 cut(s) 51, 85
Kzo9I GATC 1 cut(s) 123
LguI GCTCTTC 1 cut(s) 80
LmnI GCTCC 1 cut(s) 228
LpnPI CCDG 5 cut(s) 30, 70, 83, 148, 239
LweI GCATC 1 cut(s) 240
MaeII ACGT 1 cut(s) 237
MalI GATC 1 cut(s) 125
MboI GATC 1 cut(s) 123
MboII GAAGA 2 cut(s) 36, 67
MlyI GAGTC 1 cut(s) 200
MmeI TCCRAC 1 cut(s) 77
MnlI CCTC 2 cut(s) 52, 197
MslI CAYNNNNRTG 1 cut(s) 240
MspI CCGG 4 cut(s) 17, 57, 135, 226
MspR9I CCNGG 1 cut(s) 226
NciI CCSGG 1 cut(s) 226
NdeII GATC 1 cut(s) 123
NlaIII CATG 2 cut(s) 51, 85
PaeR7I CTCGAG 1 cut(s) 188
PciSI GCTCTTC 1 cut(s) 80
PcsI WCGNNNNNNNCGW 1 cut(s) 147
PfeI GAWTC 1 cut(s) 11
PleI GAGTC 1 cut(s) 199
PpsI GAGTC 1 cut(s) 199
PspPI GGNCC 1 cut(s) 33
PspXI VCTCGAGB 1 cut(s) 188
RseI CAYNNNNRTG 1 cut(s) 240
SapI GCTCTTC 1 cut(s) 80
Sau3AI GATC 1 cut(s) 123
Sau96I GGNCC 1 cut(s) 33
SchI GAGTC 1 cut(s) 200
ScrFI CCNGG 1 cut(s) 226
SetI ASST 5 cut(s) 75, 92, 117, 189, 240
SfaNI GCATC 1 cut(s) 240
Sfr274I CTCGAG 1 cut(s) 188
SlaI CTCGAG 1 cut(s) 188
SmiMI CAYNNNNRTG 1 cut(s) 240
SmlI CTYRAG 1 cut(s) 188
SmoI CTYRAG 1 cut(s) 188
StyD4I CCNGG 1 cut(s) 224
TaiI ACGT 1 cut(s) 240
TaqI TCGA 4 cut(s) 78, 189, 213, 240
TfiI GAWTC 1 cut(s) 11
TspDTI ATGAA 2 cut(s) 36, 157
XhoI CTCGAG 1 cut(s) 188
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.