RchiOBHm_Chr1g0384011

Rab subfamily of small GTPases

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
OG0001046
Physical Location & Seq
Forward (+)
68080233 .. 68080735
503 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ60688

Sequence Viewer

Length: 240 bp
ATGGTTATGGCAGGTCTGGGGTGGTATGAGGAGTATAACATATTGGCGTACAAGGTCGATCACGAATATGATTACCTCTTCAAGATTGTATTGATTGGAGATTCGGGTGTCGGAATTGAAAGTCCAACACTCTTTCCTGCAGGTTTACGAGGAATGAGTTTTGTTTCTCTTTCCAGGTTTACGAGGAATGAGTTTTGTTTGGAGTCCAAGTCCACCATTGGAGTTGAATTTGCAACCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04144 ko04961 ko04962 ko04972 map04144 map04961 map04962 map04972
Pfam Domains
Protein Families
Ras

Protein Analysis

79

Amino Acids

8.88

Weight (kDa)

4.72

Isoelectric Point (pI)

54.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 2 cut(s) 2, 131
AcsI RAATTY 1 cut(s) 227
AfaI GTAC 1 cut(s) 50
AgsI TTSAA 3 cut(s) 82, 119, 227
AjnI CCWGG 1 cut(s) 173
ApoI RAATTY 1 cut(s) 227
BciT130I CCWGG 1 cut(s) 175
BfaI CTAG 1 cut(s) 238
BfmI CTRYAG 1 cut(s) 138
BfuAI ACCTGC 2 cut(s) 2, 131
Bme1390I CCNGG 1 cut(s) 175
BmrFI CCNGG 1 cut(s) 175
BsaXI ACNNNNNCTCC 2 cut(s) 194, 224
BseBI CCWGG 1 cut(s) 175
BseRI GAGGAG 1 cut(s) 44
Bsp143I GATC 1 cut(s) 58
BspMAI CTGCAG 1 cut(s) 142
BspMI ACCTGC 2 cut(s) 2, 131
BssMI GATC 1 cut(s) 58
Bst2UI CCWGG 1 cut(s) 175
Bst6I CTCTTC 1 cut(s) 83
BstKTI GATC 1 cut(s) 61
BstMBI GATC 1 cut(s) 58
BstNI CCWGG 1 cut(s) 175
BstSCI CCNGG 1 cut(s) 173
BstSFI CTRYAG 1 cut(s) 138
BveI ACCTGC 2 cut(s) 2, 131
Csp6I GTAC 1 cut(s) 49
CviQI GTAC 1 cut(s) 49
DpnI GATC 1 cut(s) 60
DpnII GATC 1 cut(s) 58
Eam1104I CTCTTC 1 cut(s) 83
EarI CTCTTC 1 cut(s) 83
EcoRII CCWGG 1 cut(s) 173
FaiI YATR 5 cut(s) 8, 27, 36, 41, 69
FspBI CTAG 1 cut(s) 238
HinfI GANTC 2 cut(s) 101, 203
Hpy166II GTNNAC 3 cut(s) 146, 180, 213
Hpy188I TCNGA 1 cut(s) 113
Hpy188III TCNNGA 2 cut(s) 62, 82
Hpy8I GTNNAC 3 cut(s) 146, 180, 213
HpyCH4V TGCA 2 cut(s) 140, 233
Kzo9I GATC 1 cut(s) 58
LpnPI CCDG 5 cut(s) 2, 126, 150, 160, 187
MaeI CTAG 1 cut(s) 238
MalI GATC 1 cut(s) 60
MboI GATC 1 cut(s) 58
MboII GAAGA 1 cut(s) 70
MluCI AATT 2 cut(s) 114, 227
MlyI GAGTC 1 cut(s) 212
MmeI TCCRAC 2 cut(s) 91, 149
MnlI CCTC 4 cut(s) 22, 86, 143, 177
MslI CAYNNNNRTG 1 cut(s) 66
MspR9I CCNGG 1 cut(s) 175
MvaI CCWGG 1 cut(s) 175
NdeII GATC 1 cut(s) 58
PfeI GAWTC 1 cut(s) 101
PleI GAGTC 1 cut(s) 211
PpsI GAGTC 1 cut(s) 211
Psp6I CCWGG 1 cut(s) 173
PspGI CCWGG 1 cut(s) 173
PstI CTGCAG 1 cut(s) 142
RsaI GTAC 1 cut(s) 50
RsaNI GTAC 1 cut(s) 49
RseI CAYNNNNRTG 1 cut(s) 66
Sau3AI GATC 1 cut(s) 58
SbfI CCTGCAGG 1 cut(s) 142
SchI GAGTC 1 cut(s) 212
ScrFI CCNGG 1 cut(s) 175
SdaI CCTGCAGG 1 cut(s) 142
SetI ASST 6 cut(s) 16, 57, 78, 145, 179, 239
SfcI CTRYAG 1 cut(s) 138
SmiMI CAYNNNNRTG 1 cut(s) 66
Sse8387I CCTGCAGG 1 cut(s) 142
Sse9I AATT 2 cut(s) 114, 227
SspMI CTAG 1 cut(s) 238
StyD4I CCNGG 1 cut(s) 173
TaqI TCGA 1 cut(s) 57
TasI AATT 2 cut(s) 114, 227
TfiI GAWTC 1 cut(s) 101
XapI RAATTY 1 cut(s) 227
XspI CTAG 1 cut(s) 238
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.