Rh7BG309900

Ras-related protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
Physical Location & Seq
Forward (+)
29852621 .. 29852791
171 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG309900.1

Sequence Viewer

Length: 171 bp
ATGGCCTACAGGTCGGACGACGACTACCACTTCAAGGTCATCTTGATAAGCGATTCCGGCATCGGCAAATCCGATTTGTTGTCCAGGTTCATGCGCAACGAGTTCAACCTCGAGTCTAAGTCCACCATCGGTGTCGAGTTTGCCACCCGGAGCATCCACGTCGATGATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

56

Amino Acids

6.43

Weight (kDa)

5.13

Isoelectric Point (pI)

31.95

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ras PF00071 12 - 55 2.5e-11 Ras family
Roc PF08477 12 - 52 1.3e-09 Ras of Complex, Roc, domain of DAPkinase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 95
AfiI CCNNNNNNNGG 1 cut(s) 34
AgsI TTSAA 2 cut(s) 34, 106
AjiI CACGTC 1 cut(s) 160
AjnI CCWGG 1 cut(s) 83
Ama87I CYCGRG 1 cut(s) 110
AoxI GGCC 1 cut(s) 3
AspLEI GCGC 1 cut(s) 96
AsuC2I CCSGG 1 cut(s) 148
AvaI CYCGRG 1 cut(s) 110
BccI CCATC 1 cut(s) 134
BcgI CGANNNNNNTGC 1 cut(s) 142
BciT130I CCWGG 1 cut(s) 85
BcnI CCSGG 1 cut(s) 148
BfmI CTRYAG 1 cut(s) 7
Bme1390I CCNGG 2 cut(s) 85, 148
BmeT110I CYCGRG 1 cut(s) 110
BmgBI CACGTC 1 cut(s) 160
BmrFI CCNGG 2 cut(s) 85, 148
BmsI GCATC 2 cut(s) 69, 162
BpuMI CCSGG 1 cut(s) 148
Bsc4I CCNNNNNNNGG 1 cut(s) 34
BseBI CCWGG 1 cut(s) 85
BseGI GGATG 1 cut(s) 153
BseLI CCNNNNNNNGG 1 cut(s) 34
BshFI GGCC 1 cut(s) 5
BsiHKCI CYCGRG 1 cut(s) 110
BsiSI CCGG 2 cut(s) 57, 148
BslI CCNNNNNNNGG 1 cut(s) 34
BsnI GGCC 1 cut(s) 5
BsoBI CYCGRG 1 cut(s) 110
BspANI GGCC 1 cut(s) 5
Bst2UI CCWGG 1 cut(s) 85
BstDEI CTNAG 1 cut(s) 117
BstF5I GGATG 1 cut(s) 153
BstHHI GCGC 1 cut(s) 96
BstMWI GCNNNNNNNGC 1 cut(s) 57
BstNI CCWGG 1 cut(s) 85
BstSCI CCNGG 2 cut(s) 83, 146
BstSFI CTRYAG 1 cut(s) 7
BsuRI GGCC 1 cut(s) 5
BtrI CACGTC 1 cut(s) 160
BtsCI GGATG 1 cut(s) 153
CfoI GCGC 1 cut(s) 96
CviAII CATG 1 cut(s) 91
CviJI RGCY 1 cut(s) 5
CviKI_1 RGCY 1 cut(s) 5
DdeI CTNAG 1 cut(s) 117
Eco88I CYCGRG 1 cut(s) 110
EcoRII CCWGG 1 cut(s) 83
FaeI CATG 1 cut(s) 94
FaiI YATR 1 cut(s) 92
FalI AAGNNNNNCTT 2 cut(s) 26, 58
FatI CATG 1 cut(s) 90
FokI GGATG 1 cut(s) 140
FspI TGCGCA 1 cut(s) 95
GlaI GCGC 1 cut(s) 95
HaeIII GGCC 1 cut(s) 5
HapII CCGG 2 cut(s) 57, 148
HhaI GCGC 1 cut(s) 96
Hin1II CATG 1 cut(s) 94
Hin6I GCGC 1 cut(s) 94
HinP1I GCGC 1 cut(s) 94
HinfI GANTC 2 cut(s) 53, 113
HpaII CCGG 2 cut(s) 57, 148
Hpy166II GTNNAC 1 cut(s) 123
Hpy188I TCNGA 2 cut(s) 16, 73
Hpy188III TCNNGA 1 cut(s) 43
Hpy8I GTNNAC 1 cut(s) 123
Hpy99I CGWCG 2 cut(s) 23, 164
HpyCH4IV ACGT 1 cut(s) 159
HpyF10VI GCNNNNNNNGC 1 cut(s) 57
HpyF3I CTNAG 1 cut(s) 117
HpySE526I ACGT 1 cut(s) 159
Hsp92II CATG 1 cut(s) 94
HspAI GCGC 1 cut(s) 94
LmnI GCTCC 1 cut(s) 150
LpnPI CCDG 4 cut(s) 70, 70, 97, 161
LweI GCATC 2 cut(s) 69, 162
MaeII ACGT 1 cut(s) 159
MlyI GAGTC 1 cut(s) 122
MnlI CCTC 1 cut(s) 119
MslI CAYNNNNRTG 1 cut(s) 162
MspI CCGG 2 cut(s) 57, 148
MspR9I CCNGG 2 cut(s) 85, 148
MvaI CCWGG 1 cut(s) 85
MwoI GCNNNNNNNGC 1 cut(s) 57
NciI CCSGG 1 cut(s) 148
NlaIII CATG 1 cut(s) 94
NsbI TGCGCA 1 cut(s) 95
PaeR7I CTCGAG 1 cut(s) 110
PcsI WCGNNNNNNNCGW 1 cut(s) 69
PfeI GAWTC 1 cut(s) 53
PleI GAGTC 1 cut(s) 121
PpsI GAGTC 1 cut(s) 121
Psp6I CCWGG 1 cut(s) 83
PspGI CCWGG 1 cut(s) 83
PspXI VCTCGAGB 1 cut(s) 110
RseI CAYNNNNRTG 1 cut(s) 162
SchI GAGTC 1 cut(s) 122
ScrFI CCNGG 2 cut(s) 85, 148
SetI ASST 5 cut(s) 14, 39, 89, 111, 162
SfaNI GCATC 2 cut(s) 69, 162
SfcI CTRYAG 1 cut(s) 7
Sfr274I CTCGAG 1 cut(s) 110
SlaI CTCGAG 1 cut(s) 110
SmiMI CAYNNNNRTG 1 cut(s) 162
SmlI CTYRAG 1 cut(s) 110
SmoI CTYRAG 1 cut(s) 110
StyD4I CCNGG 2 cut(s) 83, 146
TaiI ACGT 1 cut(s) 162
TaqI TCGA 3 cut(s) 111, 135, 162
TfiI GAWTC 1 cut(s) 53
TspDTI ATGAA 1 cut(s) 79
XhoI CTCGAG 1 cut(s) 110
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.