Rroxscaffold_1G00024270

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
OG0001046
Physical Location & Seq
Reverse (-)
30168687 .. 30175695
7009 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00024270.1

Sequence Viewer

Length: 249 bp
ATGGTCGGGTCAACAGCCCATGTTGTTCAAATGGAAAGAACATACATTCATAACTTGATGGCAACCTCAAGCTCAAAGTCTGCAAAAGTCTCCAAAAGAGCTGCAGCTGCAACTCCTTCAACAAGTGCCACTGCTGGGACCTCAAAATCTGCAAAACCACCAAAACAAGGGCTGCTGCCATCAAGAAAAGCTAAAGACGGAGGACTAGAGGAGCAACGCATGGCATGGAGCATGGCAGCATGGAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

82

Amino Acids

8.63

Weight (kDa)

10.51

Isoelectric Point (pI)

46.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 2 cut(s) 135, 167
AgsI TTSAA 2 cut(s) 29, 120
AluBI AGCT 4 cut(s) 72, 101, 107, 191
AluI AGCT 4 cut(s) 72, 101, 107, 191
Alw26I GTCTC 1 cut(s) 94
ApeKI GCWGC 6 cut(s) 101, 104, 107, 172, 175, 236
AspS9I GGNCC 1 cut(s) 138
AvaII GGWCC 1 cut(s) 138
BbvI GCAGC 5 cut(s) 88, 94, 116, 159, 162
BccI CCATC 2 cut(s) 52, 187
BcoDI GTCTC 1 cut(s) 94
BfaI CTAG 1 cut(s) 206
BfmI CTRYAG 1 cut(s) 102
BisI GCNGC 6 cut(s) 102, 105, 108, 173, 176, 237
BlsI GCNGC 6 cut(s) 103, 106, 109, 174, 177, 238
Bme18I GGWCC 1 cut(s) 138
BmgT120I GGNCC 1 cut(s) 138
BmiI GGNNCC 1 cut(s) 139
BpuEI CTTGAG 1 cut(s) 52
Bsc4I CCNNNNNNNGG 2 cut(s) 135, 167
BseLI CCNNNNNNNGG 2 cut(s) 135, 167
BseRI GAGGAG 1 cut(s) 224
BseXI GCAGC 5 cut(s) 88, 94, 116, 159, 162
BseYI CCCAGC 1 cut(s) 134
BslFI GGGAC 1 cut(s) 151
BslI CCNNNNNNNGG 2 cut(s) 135, 167
BsmAI GTCTC 1 cut(s) 94
BsmFI GGGAC 1 cut(s) 151
BspLI GGNNCC 1 cut(s) 139
BspMAI CTGCAG 1 cut(s) 106
BstMAI GTCTC 1 cut(s) 94
BstMWI GCNNNNNNNGC 1 cut(s) 107
BstSFI CTRYAG 1 cut(s) 102
BstV1I GCAGC 5 cut(s) 88, 94, 116, 159, 162
BtsI GCAGTG 1 cut(s) 129
BtsIMutI CAGTG 1 cut(s) 129
Cfr13I GGNCC 1 cut(s) 138
CviAII CATG 5 cut(s) 20, 220, 225, 232, 240
CviJI RGCY 6 cut(s) 17, 72, 101, 107, 172, 191
CviKI_1 RGCY 6 cut(s) 17, 72, 101, 107, 172, 191
Eco47I GGWCC 1 cut(s) 138
EcoO109I RGGNCCY 1 cut(s) 138
FaeI CATG 5 cut(s) 23, 223, 228, 235, 243
FaiI YATR 7 cut(s) 21, 43, 51, 221, 226, 233, 241
FaqI GGGAC 1 cut(s) 151
FatI CATG 5 cut(s) 19, 219, 224, 231, 239
Fnu4HI GCNGC 6 cut(s) 102, 105, 108, 173, 176, 237
Fsp4HI GCNGC 6 cut(s) 102, 105, 108, 173, 176, 237
FspBI CTAG 1 cut(s) 206
GluI GCNGC 6 cut(s) 102, 105, 108, 173, 176, 237
GsaI CCCAGC 1 cut(s) 138
Hin1II CATG 5 cut(s) 23, 223, 228, 235, 243
HincII GTYRAC 1 cut(s) 12
HindII GTYRAC 1 cut(s) 12
Hpy166II GTNNAC 1 cut(s) 12
Hpy188III TCNNGA 1 cut(s) 183
Hpy8I GTNNAC 1 cut(s) 12
HpyAV CCTTC 1 cut(s) 126
HpyCH4V TGCA 4 cut(s) 83, 104, 110, 152
HpyF10VI GCNNNNNNNGC 1 cut(s) 107
Hsp92II CATG 5 cut(s) 23, 223, 228, 235, 243
LmnI GCTCC 2 cut(s) 211, 228
LpnPI CCDG 1 cut(s) 120
Lsp1109I GCAGC 5 cut(s) 88, 94, 116, 159, 162
MaeI CTAG 1 cut(s) 206
MnlI CCTC 4 cut(s) 76, 151, 194, 202
MspA1I CMGCKG 1 cut(s) 107
MwoI GCNNNNNNNGC 1 cut(s) 107
NlaIII CATG 5 cut(s) 23, 223, 228, 235, 243
NlaIV GGNNCC 1 cut(s) 139
PkrI GCNGC 6 cut(s) 103, 106, 109, 174, 177, 238
PpuMI RGGWCCY 1 cut(s) 138
Psp5II RGGWCCY 1 cut(s) 138
PspFI CCCAGC 1 cut(s) 134
PspN4I GGNNCC 1 cut(s) 139
PspPI GGNCC 1 cut(s) 138
PspPPI RGGWCCY 1 cut(s) 138
PstI CTGCAG 1 cut(s) 106
PvuII CAGCTG 1 cut(s) 107
SatI GCNGC 6 cut(s) 102, 105, 108, 173, 176, 237
Sau96I GGNCC 1 cut(s) 138
SetI ASST 6 cut(s) 68, 74, 103, 109, 143, 193
SfcI CTRYAG 1 cut(s) 102
SinI GGWCC 1 cut(s) 138
SmlI CTYRAG 1 cut(s) 67
SmoI CTYRAG 1 cut(s) 67
SspMI CTAG 1 cut(s) 206
TscAI CASTG 1 cut(s) 136
TseI GCWGC 6 cut(s) 101, 104, 107, 172, 175, 236
TspDTI ATGAA 1 cut(s) 38
TspGWI ACGGA 1 cut(s) 213
TspRI CASTG 1 cut(s) 136
VpaK11BI GGWCC 1 cut(s) 138
XspI CTAG 1 cut(s) 206
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.