Rroxscaffold_2G00114590

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
40775303 .. 40778439
3137 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00114590.1

Sequence Viewer

Length: 396 bp
ATGGCAACCTCATCGGATTCAAGTCATACAGTCAGTTCTCATTATGATGGTGATAATGATGAAATGGTTGTTGTTGGGAATGATGCAAATGATGTGTCTCAGCAAGGTGAAGACAAGGAACCAGCCAGAGAAACGAAGCTGCTGATCAAACAGAAAATGAAGCACCAACTCGGGCATCCCGAGCAAAGGGGAAAAGCAAGAGCTGCTGAAAGTGATGAAGAAGAACCAACTGCCAAAGCCGGAACCTCAAGCTCAAAGTCTTCAAAAGTCTCCAAAAGAGCTGCAGCTGCAACTCCTTCAACAAGTGCTGCTGCTGGGACCTCAAAATCTGCAAAAGCACCAAAACAAGGGCTGCTGCCACCAAGAAAACCTAAAGCCTTGTTGAGTTGTTGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

131

Amino Acids

13.7

Weight (kDa)

8.89

Isoelectric Point (pI)

52.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 2 cut(s) 186, 347
AgsI TTSAA 3 cut(s) 21, 264, 300
AluBI AGCT 5 cut(s) 139, 203, 252, 281, 287
AluI AGCT 5 cut(s) 139, 203, 252, 281, 287
Alw26I GTCTC 2 cut(s) 102, 274
Ama87I CYCGRG 2 cut(s) 170, 179
ApeKI GCWGC 9 cut(s) 139, 203, 281, 284, 287, 308, 311, 352, 355
ArsI GACNNNNNNTTYG 2 cut(s) 80, 112
AspS9I GGNCC 1 cut(s) 318
AsuHPI GGTGA 2 cut(s) 62, 119
AvaI CYCGRG 2 cut(s) 170, 179
AvaII GGWCC 1 cut(s) 318
BbsI GAAGAC 2 cut(s) 117, 252
BbvI GCAGC 9 cut(s) 126, 190, 268, 274, 295, 296, 298, 339, 342
BccI CCATC 1 cut(s) 41
BcgI CGANNNNNNTGC 1 cut(s) 28
BclI TGATCA 1 cut(s) 144
BcoDI GTCTC 2 cut(s) 102, 274
BfaI CTAG 1 cut(s) 394
BfmI CTRYAG 1 cut(s) 282
BisI GCNGC 9 cut(s) 140, 204, 282, 285, 288, 309, 312, 353, 356
BlsI GCNGC 9 cut(s) 141, 205, 283, 286, 289, 310, 313, 354, 357
Bme18I GGWCC 1 cut(s) 318
BmeT110I CYCGRG 2 cut(s) 170, 179
BmgT120I GGNCC 1 cut(s) 318
BmiI GGNNCC 3 cut(s) 120, 244, 319
BmsI GCATC 2 cut(s) 73, 184
BpiI GAAGAC 2 cut(s) 117, 252
BpuEI CTTGAG 1 cut(s) 232
Bsc4I CCNNNNNNNGG 2 cut(s) 186, 347
BseGI GGATG 1 cut(s) 175
BseLI CCNNNNNNNGG 2 cut(s) 186, 347
BseMII CTCAG 1 cut(s) 113
BseXI GCAGC 9 cut(s) 126, 190, 268, 274, 295, 296, 298, 339, 342
BseYI CCCAGC 1 cut(s) 314
BsiHKCI CYCGRG 2 cut(s) 170, 179
BsiSI CCGG 1 cut(s) 240
BslFI GGGAC 1 cut(s) 331
BslI CCNNNNNNNGG 2 cut(s) 186, 347
BsmAI GTCTC 2 cut(s) 102, 274
BsmFI GGGAC 1 cut(s) 331
BsoBI CYCGRG 2 cut(s) 170, 179
Bsp143I GATC 1 cut(s) 144
BspCNI CTCAG 1 cut(s) 112
BspLI GGNNCC 3 cut(s) 120, 244, 319
BspMAI CTGCAG 1 cut(s) 286
BssMI GATC 1 cut(s) 144
Bst4CI ACNGT 1 cut(s) 31
BstAPI GCANNNNNTGC 1 cut(s) 203
BstDEI CTNAG 1 cut(s) 99
BstF5I GGATG 1 cut(s) 175
BstKTI GATC 1 cut(s) 147
BstMAI GTCTC 2 cut(s) 102, 274
BstMBI GATC 1 cut(s) 144
BstMWI GCNNNNNNNGC 3 cut(s) 181, 203, 287
BstSFI CTRYAG 1 cut(s) 282
BstV1I GCAGC 9 cut(s) 126, 190, 268, 274, 295, 296, 298, 339, 342
BstV2I GAAGAC 2 cut(s) 117, 252
BtsCI GGATG 1 cut(s) 175
Cfr13I GGNCC 1 cut(s) 318
CviJI RGCY 9 cut(s) 125, 139, 203, 239, 252, 281, 287, 352, 377
CviKI_1 RGCY 9 cut(s) 125, 139, 203, 239, 252, 281, 287, 352, 377
DdeI CTNAG 1 cut(s) 99
DpnI GATC 1 cut(s) 146
DpnII GATC 1 cut(s) 144
Eco47I GGWCC 1 cut(s) 318
Eco88I CYCGRG 2 cut(s) 170, 179
EcoO109I RGGNCCY 1 cut(s) 318
FaiI YATR 2 cut(s) 27, 45
FaqI GGGAC 1 cut(s) 331
FbaI TGATCA 1 cut(s) 144
Fnu4HI GCNGC 9 cut(s) 140, 204, 282, 285, 288, 309, 312, 353, 356
FokI GGATG 1 cut(s) 162
Fsp4HI GCNGC 9 cut(s) 140, 204, 282, 285, 288, 309, 312, 353, 356
FspBI CTAG 1 cut(s) 394
GluI GCNGC 9 cut(s) 140, 204, 282, 285, 288, 309, 312, 353, 356
GsaI CCCAGC 1 cut(s) 318
HapII CCGG 1 cut(s) 240
HinfI GANTC 1 cut(s) 17
HpaII CCGG 1 cut(s) 240
HphI GGTGA 2 cut(s) 62, 119
Hpy188I TCNGA 1 cut(s) 16
Hpy188III TCNNGA 1 cut(s) 179
HpyAV CCTTC 1 cut(s) 306
HpyCH4III ACNGT 1 cut(s) 31
HpyCH4V TGCA 4 cut(s) 86, 284, 290, 332
HpyF10VI GCNNNNNNNGC 3 cut(s) 181, 203, 287
HpyF3I CTNAG 1 cut(s) 99
Ksp22I TGATCA 1 cut(s) 144
Kzo9I GATC 1 cut(s) 144
LpnPI CCDG 4 cut(s) 135, 139, 253, 300
Lsp1109I GCAGC 9 cut(s) 126, 190, 268, 274, 295, 296, 298, 339, 342
LweI GCATC 2 cut(s) 73, 184
MaeI CTAG 1 cut(s) 394
MalI GATC 1 cut(s) 146
MboI GATC 1 cut(s) 144
MboII GAAGA 4 cut(s) 122, 230, 233, 252
MnlI CCTC 3 cut(s) 19, 256, 331
MslI CAYNNNNRTG 1 cut(s) 45
MspA1I CMGCKG 1 cut(s) 287
MspI CCGG 1 cut(s) 240
MwoI GCNNNNNNNGC 3 cut(s) 181, 203, 287
NdeII GATC 1 cut(s) 144
NlaIV GGNNCC 3 cut(s) 120, 244, 319
PcsI WCGNNNNNNNCGW 1 cut(s) 177
PfeI GAWTC 1 cut(s) 17
PkrI GCNGC 9 cut(s) 141, 205, 283, 286, 289, 310, 313, 354, 357
PpuMI RGGWCCY 1 cut(s) 318
Psp5II RGGWCCY 1 cut(s) 318
PspFI CCCAGC 1 cut(s) 314
PspN4I GGNNCC 3 cut(s) 120, 244, 319
PspPI GGNCC 1 cut(s) 318
PspPPI RGGWCCY 1 cut(s) 318
PstI CTGCAG 1 cut(s) 286
PvuII CAGCTG 1 cut(s) 287
RseI CAYNNNNRTG 1 cut(s) 45
SatI GCNGC 9 cut(s) 140, 204, 282, 285, 288, 309, 312, 353, 356
Sau3AI GATC 1 cut(s) 144
Sau96I GGNCC 1 cut(s) 318
SfaNI GCATC 2 cut(s) 73, 184
SfcI CTRYAG 1 cut(s) 282
SinI GGWCC 1 cut(s) 318
SmiMI CAYNNNNRTG 1 cut(s) 45
SmlI CTYRAG 1 cut(s) 247
SmoI CTYRAG 1 cut(s) 247
SspMI CTAG 1 cut(s) 394
TaaI ACNGT 1 cut(s) 31
TfiI GAWTC 1 cut(s) 17
TseI GCWGC 9 cut(s) 139, 203, 281, 284, 287, 308, 311, 352, 355
TspDTI ATGAA 3 cut(s) 75, 173, 231
VpaK11BI GGWCC 1 cut(s) 318
XspI CTAG 1 cut(s) 394
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.