Rh1AG292600

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
OG0001046
Physical Location & Seq
Reverse (-)
52242845 .. 52243092
248 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG292600.1

Sequence Viewer

Length: 198 bp
ATGGCAGTAGTCCGCTTTGCTAATCCTTTGGTTCCGTTTAATAACAAGAAGTTGGATCGCTACATTTATGGTGTTGTTAGTGGGACTGAAGGTGCTTTGATTCATGGTATGAGCGTCGCTAGTGTGGCTAAGAACGACAAAAAGGATAATGGTGGTATAGATGCTTCTAATGGGGATGGTGGCCCACATTTTAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

65

Amino Acids

6.85

Weight (kDa)

9.16

Isoelectric Point (pI)

16.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 13
AclWI GGATC 1 cut(s) 63
AcuI CTGAAG 1 cut(s) 108
AlwI GGATC 1 cut(s) 63
AoxI GGCC 1 cut(s) 181
AspS9I GGNCC 1 cut(s) 182
BarI GAAGNNNNNNTAC 2 cut(s) 148, 180
BccI CCATC 1 cut(s) 170
BfaI CTAG 1 cut(s) 120
BmgT120I GGNCC 1 cut(s) 182
BmiI GGNNCC 1 cut(s) 33
BmsI GCATC 1 cut(s) 151
BseGI GGATG 1 cut(s) 181
BshFI GGCC 1 cut(s) 183
BslFI GGGAC 1 cut(s) 97
BsmFI GGGAC 1 cut(s) 97
BsnI GGCC 1 cut(s) 183
Bsp143I GATC 1 cut(s) 55
BspACI CCGC 1 cut(s) 13
BspANI GGCC 1 cut(s) 183
BspLI GGNNCC 1 cut(s) 33
BspPI GGATC 1 cut(s) 63
BssMI GATC 1 cut(s) 55
BstDEI CTNAG 1 cut(s) 129
BstF5I GGATG 1 cut(s) 181
BstKTI GATC 1 cut(s) 58
BstMBI GATC 1 cut(s) 55
BstMWI GCNNNNNNNGC 1 cut(s) 125
BsuRI GGCC 1 cut(s) 183
BtsCI GGATG 1 cut(s) 181
Cfr13I GGNCC 1 cut(s) 182
CseI GACGC 1 cut(s) 103
CviAII CATG 1 cut(s) 104
CviJI RGCY 2 cut(s) 128, 183
CviKI_1 RGCY 2 cut(s) 128, 183
DdeI CTNAG 1 cut(s) 129
DpnI GATC 1 cut(s) 57
DpnII GATC 1 cut(s) 55
DraI TTTAAA 1 cut(s) 193
Eco57I CTGAAG 1 cut(s) 108
FaeI CATG 1 cut(s) 107
FaiI YATR 4 cut(s) 69, 105, 110, 158
FaqI GGGAC 1 cut(s) 97
FatI CATG 1 cut(s) 103
FokI GGATG 1 cut(s) 188
FspBI CTAG 1 cut(s) 120
HaeIII GGCC 1 cut(s) 183
HgaI GACGC 1 cut(s) 103
Hin1II CATG 1 cut(s) 107
HinfI GANTC 1 cut(s) 100
Hpy99I CGWCG 1 cut(s) 119
HpyAV CCTTC 1 cut(s) 83
HpyF10VI GCNNNNNNNGC 1 cut(s) 125
HpyF3I CTNAG 1 cut(s) 129
Hsp92II CATG 1 cut(s) 107
Kzo9I GATC 1 cut(s) 55
LweI GCATC 1 cut(s) 151
MaeI CTAG 1 cut(s) 120
MalI GATC 1 cut(s) 57
MboI GATC 1 cut(s) 55
MmeI TCCRAC 1 cut(s) 33
MseI TTAA 2 cut(s) 39, 192
MwoI GCNNNNNNNGC 1 cut(s) 125
NdeII GATC 1 cut(s) 55
NlaIII CATG 1 cut(s) 107
NlaIV GGNNCC 1 cut(s) 33
PfeI GAWTC 1 cut(s) 100
PspN4I GGNNCC 1 cut(s) 33
PspPI GGNCC 1 cut(s) 182
SaqAI TTAA 2 cut(s) 39, 192
Sau3AI GATC 1 cut(s) 55
Sau96I GGNCC 1 cut(s) 182
SetI ASST 1 cut(s) 94
SfaNI GCATC 1 cut(s) 151
SgeI CNNG 3 cut(s) 58, 116, 132
SsiI CCGC 1 cut(s) 13
SspMI CTAG 1 cut(s) 120
TfiI GAWTC 1 cut(s) 100
Tru1I TTAA 2 cut(s) 39, 192
Tru9I TTAA 2 cut(s) 39, 192
TspDTI ATGAA 1 cut(s) 92
TspGWI ACGGA 1 cut(s) 24
XspI CTAG 1 cut(s) 120
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.