Rh4CG067200

Ras-related protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
OG0001046
Physical Location & Seq
Forward (+)
12612747 .. 12612998
252 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG067200.1

Sequence Viewer

Length: 252 bp
ATGAGCACTGATTCTCCTGCGACGACGACAAGGCCCTCAGCCTCTTCATCTCCAACCGGAAATTCTCTCCGGCTCTTCGACATGGCCTACAAGTCGGATGACGACTACCACTTTAAGGTCGTCTTGATCGGCGATTCCGGCATCGGCAAATTGGATTTGTTGTCCAGGTTCATGCGCAACGAGTTCAACATTGAGTCTAAGTCCACCATCGATGTCGAGTTTGCCACCCGAAGCATCCACGTCGATGATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04144 ko04961 ko04962 ko04972 map04144 map04961 map04962 map04972
Pfam Domains
Protein Families
Ras

Protein Analysis

83

Amino Acids

9.21

Weight (kDa)

4.94

Isoelectric Point (pI)

60.37

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ras PF00071 39 - 82 2.5e-10 Ras family
Roc PF08477 39 - 79 6.7e-09 Ras of Complex, Roc, domain of DAPkinase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 176
AcsI RAATTY 1 cut(s) 61
AfiI CCNNNNNNNGG 1 cut(s) 115
AgsI TTSAA 1 cut(s) 187
AjiI CACGTC 1 cut(s) 241
AjnI CCWGG 1 cut(s) 164
AjuI GAANNNNNNNTTGG 2 cut(s) 46, 78
Alw21I GWGCWC 1 cut(s) 8
AoxI GGCC 2 cut(s) 32, 84
ApoI RAATTY 1 cut(s) 61
AspLEI GCGC 1 cut(s) 177
AspS9I GGNCC 1 cut(s) 33
Bbv12I GWGCWC 1 cut(s) 8
BbvCI CCTCAGC 1 cut(s) 37
BccI CCATC 1 cut(s) 215
BcgI CGANNNNNNTGC 1 cut(s) 223
BciT130I CCWGG 1 cut(s) 166
Bme1390I CCNGG 1 cut(s) 166
BmgBI CACGTC 1 cut(s) 241
BmgT120I GGNCC 1 cut(s) 33
BmrFI CCNGG 1 cut(s) 166
BmsI GCATC 2 cut(s) 150, 243
Bpu10I CCTNAGC 1 cut(s) 37
Bsa29I ATCGAT 1 cut(s) 210
BsaWI WCCGGW 1 cut(s) 56
BsaXI ACNNNNNCTCC 1 cut(s) 28
Bsc4I CCNNNNNNNGG 1 cut(s) 115
BseBI CCWGG 1 cut(s) 166
BseCI ATCGAT 1 cut(s) 210
BseGI GGATG 2 cut(s) 103, 234
BseLI CCNNNNNNNGG 1 cut(s) 115
BseMII CTCAG 1 cut(s) 51
BshFI GGCC 2 cut(s) 34, 86
BshVI ATCGAT 1 cut(s) 210
BsiHKAI GWGCWC 1 cut(s) 8
BsiSI CCGG 3 cut(s) 57, 70, 138
BslI CCNNNNNNNGG 1 cut(s) 115
BsnI GGCC 2 cut(s) 34, 86
Bsp1286I GDGCHC 1 cut(s) 8
Bsp143I GATC 1 cut(s) 126
BspANI GGCC 2 cut(s) 34, 86
BspCNI CTCAG 1 cut(s) 50
BspDI ATCGAT 1 cut(s) 210
BspQI GCTCTTC 1 cut(s) 80
BssMI GATC 1 cut(s) 126
Bst2UI CCWGG 1 cut(s) 166
Bst6I CTCTTC 2 cut(s) 49, 80
BstDEI CTNAG 2 cut(s) 37, 198
BstF5I GGATG 2 cut(s) 103, 234
BstHHI GCGC 1 cut(s) 177
BstKTI GATC 1 cut(s) 129
BstMBI GATC 1 cut(s) 126
BstMWI GCNNNNNNNGC 1 cut(s) 138
BstNI CCWGG 1 cut(s) 166
BstSCI CCNGG 1 cut(s) 164
Bsu15I ATCGAT 1 cut(s) 210
BsuRI GGCC 2 cut(s) 34, 86
BsuTUI ATCGAT 1 cut(s) 210
BtrI CACGTC 1 cut(s) 241
BtsCI GGATG 2 cut(s) 103, 234
BtsIMutI CAGTG 1 cut(s) 6
CfoI GCGC 1 cut(s) 177
Cfr13I GGNCC 1 cut(s) 33
ClaI ATCGAT 1 cut(s) 210
CviAII CATG 2 cut(s) 82, 172
CviJI RGCY 4 cut(s) 34, 41, 73, 86
CviKI_1 RGCY 4 cut(s) 34, 41, 73, 86
DdeI CTNAG 2 cut(s) 37, 198
DpnI GATC 1 cut(s) 128
DpnII GATC 1 cut(s) 126
Eam1104I CTCTTC 2 cut(s) 49, 80
EarI CTCTTC 2 cut(s) 49, 80
EcoO109I RGGNCCY 1 cut(s) 33
EcoRII CCWGG 1 cut(s) 164
FaeI CATG 2 cut(s) 85, 175
FaiI YATR 2 cut(s) 83, 173
FalI AAGNNNNNCTT 2 cut(s) 107, 139
FatI CATG 2 cut(s) 81, 171
FokI GGATG 2 cut(s) 110, 221
FspI TGCGCA 1 cut(s) 176
GlaI GCGC 1 cut(s) 176
HaeIII GGCC 2 cut(s) 34, 86
HapII CCGG 3 cut(s) 57, 70, 138
HhaI GCGC 1 cut(s) 177
Hin1II CATG 2 cut(s) 85, 175
Hin6I GCGC 1 cut(s) 175
HinP1I GCGC 1 cut(s) 175
HinfI GANTC 3 cut(s) 11, 134, 194
HpaII CCGG 3 cut(s) 57, 70, 138
Hpy166II GTNNAC 1 cut(s) 204
Hpy188I TCNGA 1 cut(s) 97
Hpy188III TCNNGA 1 cut(s) 124
Hpy8I GTNNAC 1 cut(s) 204
Hpy99I CGWCG 3 cut(s) 25, 28, 245
HpyCH4IV ACGT 1 cut(s) 240
HpyF10VI GCNNNNNNNGC 1 cut(s) 138
HpyF3I CTNAG 2 cut(s) 37, 198
HpySE526I ACGT 1 cut(s) 240
Hsp92II CATG 2 cut(s) 85, 175
HspAI GCGC 1 cut(s) 175
Kzo9I GATC 1 cut(s) 126
LguI GCTCTTC 1 cut(s) 80
LpnPI CCDG 6 cut(s) 30, 70, 83, 151, 151, 178
LweI GCATC 2 cut(s) 150, 243
MaeII ACGT 1 cut(s) 240
MalI GATC 1 cut(s) 128
MboI GATC 1 cut(s) 126
MboII GAAGA 2 cut(s) 36, 67
MhlI GDGCHC 1 cut(s) 8
MluCI AATT 2 cut(s) 61, 149
MlyI GAGTC 1 cut(s) 203
MmeI TCCRAC 2 cut(s) 75, 77
MnlI CCTC 2 cut(s) 46, 52
MseI TTAA 1 cut(s) 114
MslI CAYNNNNRTG 1 cut(s) 243
MspI CCGG 3 cut(s) 57, 70, 138
MspR9I CCNGG 1 cut(s) 166
MvaI CCWGG 1 cut(s) 166
MwoI GCNNNNNNNGC 1 cut(s) 138
NdeII GATC 1 cut(s) 126
NlaIII CATG 2 cut(s) 85, 175
NsbI TGCGCA 1 cut(s) 176
PciSI GCTCTTC 1 cut(s) 80
PfeI GAWTC 2 cut(s) 11, 134
PleI GAGTC 1 cut(s) 202
PpsI GAGTC 1 cut(s) 202
Psp6I CCWGG 1 cut(s) 164
PspGI CCWGG 1 cut(s) 164
PspPI GGNCC 1 cut(s) 33
RseI CAYNNNNRTG 1 cut(s) 243
SapI GCTCTTC 1 cut(s) 80
SaqAI TTAA 1 cut(s) 114
Sau3AI GATC 1 cut(s) 126
Sau96I GGNCC 1 cut(s) 33
SchI GAGTC 1 cut(s) 203
ScrFI CCNGG 1 cut(s) 166
SduI GDGCHC 1 cut(s) 8
SetI ASST 3 cut(s) 120, 170, 243
SfaNI GCATC 2 cut(s) 150, 243
SmiMI CAYNNNNRTG 1 cut(s) 243
Sse9I AATT 2 cut(s) 61, 149
StyD4I CCNGG 1 cut(s) 164
TaiI ACGT 1 cut(s) 243
TaqI TCGA 4 cut(s) 78, 210, 216, 243
TasI AATT 2 cut(s) 61, 149
TfiI GAWTC 2 cut(s) 11, 134
Tru1I TTAA 1 cut(s) 114
Tru9I TTAA 1 cut(s) 114
TscAI CASTG 1 cut(s) 13
TspDTI ATGAA 2 cut(s) 36, 160
TspRI CASTG 1 cut(s) 13
XapI RAATTY 1 cut(s) 61
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.