Rmu_sc0000147.1_g000054

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000147.1
OG0001046
Physical Location & Seq
Forward (+)
243041 .. 243491
451 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000147.1_g000054.1.cds

Sequence Viewer

Length: 255 bp
atggggcggcctgatcctcacgaatccaaaaccgagatgattgaaaccggttatgagaatttaaaaaacttaatcggtatcttttgctaccttaccggaggttgccagaaatctcacaagagtagcttttgtggtcgccggaggttggccagagactcactggaggtaggccggagacctgtcggagttggccggaggtcgaccggagagttggtcagagacctcgccggagaagagagagaagatgattgttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

84

Amino Acids

9.43

Weight (kDa)

7.69

Isoelectric Point (pI)

60.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 200
AciI CCGC 1 cut(s) 7
AclWI GGATC 1 cut(s) 8
AcoI YGGCCR 2 cut(s) 147, 190
AcsI RAATTY 1 cut(s) 58
AfiI CCNNNNNNNGG 1 cut(s) 145
AgeI ACCGGT 1 cut(s) 47
AgsI TTSAA 1 cut(s) 44
AluBI AGCT 1 cut(s) 126
AluI AGCT 1 cut(s) 126
Alw26I GTCTC 3 cut(s) 147, 169, 213
AlwI GGATC 1 cut(s) 8
AoxI GGCC 4 cut(s) 8, 147, 169, 190
ApoI RAATTY 1 cut(s) 58
AsiGI ACCGGT 1 cut(s) 47
BalI TGGCCA 1 cut(s) 149
BcoDI GTCTC 3 cut(s) 147, 169, 213
BisI GCNGC 1 cut(s) 8
BlsI GCNGC 1 cut(s) 9
BpmI CTGGAG 1 cut(s) 182
BsaI GGTCTC 2 cut(s) 169, 213
BsaWI WCCGGW 3 cut(s) 47, 95, 203
BsaXI ACNNNNNCTCC 2 cut(s) 198, 228
Bsc4I CCNNNNNNNGG 1 cut(s) 145
Bse118I RCCGGY 1 cut(s) 47
Bse1I ACTGG 1 cut(s) 165
BseLI CCNNNNNNNGG 1 cut(s) 145
BseNI ACTGG 1 cut(s) 165
Bsh1285I CGRYCG 1 cut(s) 204
BshFI GGCC 4 cut(s) 10, 149, 171, 192
BshTI ACCGGT 1 cut(s) 47
BsiEI CGRYCG 1 cut(s) 204
BsiSI CCGG 7 cut(s) 48, 96, 139, 172, 193, 204, 228
BslI CCNNNNNNNGG 1 cut(s) 145
BsmAI GTCTC 3 cut(s) 147, 169, 213
BsnI GGCC 4 cut(s) 10, 149, 171, 192
Bso31I GGTCTC 2 cut(s) 169, 213
Bsp143I GATC 1 cut(s) 13
BspACI CCGC 1 cut(s) 7
BspANI GGCC 4 cut(s) 10, 149, 171, 192
BspPI GGATC 1 cut(s) 8
BspTNI GGTCTC 2 cut(s) 169, 213
BsrFI RCCGGY 1 cut(s) 47
BsrI ACTGG 1 cut(s) 165
BssAI RCCGGY 1 cut(s) 47
BssMI GATC 1 cut(s) 13
Bst6I CTCTTC 1 cut(s) 228
BstKTI GATC 1 cut(s) 16
BstMAI GTCTC 3 cut(s) 147, 169, 213
BstMBI GATC 1 cut(s) 13
BstMCI CGRYCG 1 cut(s) 204
BsuRI GGCC 4 cut(s) 10, 149, 171, 192
BtsIMutI CAGTG 1 cut(s) 158
Cfr10I RCCGGY 1 cut(s) 47
CspAI ACCGGT 1 cut(s) 47
CviJI RGCY 5 cut(s) 10, 126, 149, 171, 192
CviKI_1 RGCY 5 cut(s) 10, 126, 149, 171, 192
DpnI GATC 1 cut(s) 15
DpnII GATC 1 cut(s) 13
DraI TTTAAA 1 cut(s) 63
EaeI YGGCCR 2 cut(s) 147, 190
Eam1104I CTCTTC 1 cut(s) 228
EarI CTCTTC 1 cut(s) 228
Eco31I GGTCTC 2 cut(s) 169, 213
FaiI YATR 1 cut(s) 54
FalI AAGNNNNNCTT 2 cut(s) 110, 142
FblI GTMKAC 1 cut(s) 200
Fnu4HI GCNGC 1 cut(s) 8
Fsp4HI GCNGC 1 cut(s) 8
GluI GCNGC 1 cut(s) 8
GsuI CTGGAG 1 cut(s) 182
HaeIII GGCC 4 cut(s) 10, 149, 171, 192
HapII CCGG 7 cut(s) 48, 96, 139, 172, 193, 204, 228
HincII GTYRAC 1 cut(s) 201
HindII GTYRAC 1 cut(s) 201
HinfI GANTC 2 cut(s) 23, 155
HpaII CCGG 7 cut(s) 48, 96, 139, 172, 193, 204, 228
Hpy166II GTNNAC 1 cut(s) 201
Hpy188I TCNGA 2 cut(s) 185, 218
Hpy188III TCNNGA 1 cut(s) 20
Hpy8I GTNNAC 1 cut(s) 201
Kzo9I GATC 1 cut(s) 13
MalI GATC 1 cut(s) 15
MboI GATC 1 cut(s) 13
MboII GAAGA 2 cut(s) 245, 254
MlsI TGGCCA 1 cut(s) 149
MluCI AATT 1 cut(s) 58
MluNI TGGCCA 1 cut(s) 149
MlyI GAGTC 1 cut(s) 149
MmeI TCCRAC 1 cut(s) 163
MnlI CCTC 6 cut(s) 27, 92, 135, 157, 189, 233
Mox20I TGGCCA 1 cut(s) 149
MscI TGGCCA 1 cut(s) 149
MseI TTAA 2 cut(s) 62, 71
Msp20I TGGCCA 1 cut(s) 149
MspI CCGG 7 cut(s) 48, 96, 139, 172, 193, 204, 228
NdeII GATC 1 cut(s) 13
PfeI GAWTC 1 cut(s) 23
PinAI ACCGGT 1 cut(s) 47
PkrI GCNGC 1 cut(s) 9
PleI GAGTC 1 cut(s) 149
PpsI GAGTC 1 cut(s) 149
SalI GTCGAC 1 cut(s) 199
SaqAI TTAA 2 cut(s) 62, 71
SatI GCNGC 1 cut(s) 8
Sau3AI GATC 1 cut(s) 13
SchI GAGTC 1 cut(s) 149
SetI ASST 8 cut(s) 93, 103, 128, 146, 168, 181, 200, 225
Sse9I AATT 1 cut(s) 58
SsiI CCGC 1 cut(s) 7
TaqI TCGA 1 cut(s) 200
TasI AATT 1 cut(s) 58
TauI GCSGC 1 cut(s) 10
TfiI GAWTC 1 cut(s) 23
Tru1I TTAA 2 cut(s) 62, 71
Tru9I TTAA 2 cut(s) 62, 71
TscAI CASTG 1 cut(s) 165
TspRI CASTG 1 cut(s) 165
XapI RAATTY 1 cut(s) 58
XcmI CCANNNNNNNNNTGG 1 cut(s) 157
XmiI GTMKAC 1 cut(s) 200
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.