Rh5BG073700

Ras-related protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Forward (+)
6155972 .. 6156172
201 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG073700.1

Sequence Viewer

Length: 201 bp
ATGGCCTACAGGTCGGACGACGACTACCACTTCAAGGTCGTCTTGATTGGCCATTCCGGCTTCGGCAAATCTGATTTGTTGTCCAGGTTCATGCGCAATGAGTTCAACCTCGAGTCTAAGTCCACCATCGGTGTCGAGTTTGCCACCCGGAGCATTCATGTCAAGGCCCAGATTTGGGACACCGTCGGCCAAGAAATGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

66

Amino Acids

7.6

Weight (kDa)

6.25

Isoelectric Point (pI)

25.27

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ras PF00071 12 - 65 2e-15 Ras family
Roc PF08477 12 - 65 3.3e-14 Ras of Complex, Roc, domain of DAPkinase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 95
AcoI YGGCCR 2 cut(s) 49, 187
AfiI CCNNNNNNNGG 3 cut(s) 34, 174, 175
AgsI TTSAA 2 cut(s) 34, 106
AjnI CCWGG 1 cut(s) 83
Ama87I CYCGRG 1 cut(s) 110
AoxI GGCC 4 cut(s) 3, 49, 165, 187
AspLEI GCGC 1 cut(s) 96
AspS9I GGNCC 1 cut(s) 166
AsuC2I CCSGG 1 cut(s) 148
AvaI CYCGRG 1 cut(s) 110
BalI TGGCCA 1 cut(s) 51
BccI CCATC 1 cut(s) 134
BciT130I CCWGG 1 cut(s) 85
BcnI CCSGG 1 cut(s) 148
BfmI CTRYAG 1 cut(s) 7
BglI GCCNNNNNGGC 1 cut(s) 57
Bme1390I CCNGG 2 cut(s) 85, 148
BmeT110I CYCGRG 1 cut(s) 110
BmgT120I GGNCC 1 cut(s) 166
BmrFI CCNGG 2 cut(s) 85, 148
BpuMI CCSGG 1 cut(s) 148
Bsc4I CCNNNNNNNGG 3 cut(s) 34, 174, 175
Bse3DI GCAATG 1 cut(s) 103
BseBI CCWGG 1 cut(s) 85
BseLI CCNNNNNNNGG 3 cut(s) 34, 174, 175
BseMI GCAATG 1 cut(s) 103
BshFI GGCC 4 cut(s) 5, 51, 167, 189
BsiHKCI CYCGRG 1 cut(s) 110
BsiSI CCGG 2 cut(s) 57, 148
BslFI GGGAC 1 cut(s) 191
BslI CCNNNNNNNGG 3 cut(s) 34, 174, 175
BsmFI GGGAC 1 cut(s) 191
BsmI GAATGC 1 cut(s) 153
BsnI GGCC 4 cut(s) 5, 51, 167, 189
BsoBI CYCGRG 1 cut(s) 110
BspANI GGCC 4 cut(s) 5, 51, 167, 189
BsrDI GCAATG 1 cut(s) 103
Bst2UI CCWGG 1 cut(s) 85
Bst4CI ACNGT 1 cut(s) 184
BstDEI CTNAG 1 cut(s) 117
BstHHI GCGC 1 cut(s) 96
BstMWI GCNNNNNNNGC 1 cut(s) 57
BstNI CCWGG 1 cut(s) 85
BstSCI CCNGG 2 cut(s) 83, 146
BstSFI CTRYAG 1 cut(s) 7
BsuRI GGCC 4 cut(s) 5, 51, 167, 189
CfoI GCGC 1 cut(s) 96
Cfr13I GGNCC 1 cut(s) 166
CviAII CATG 2 cut(s) 91, 158
CviJI RGCY 5 cut(s) 5, 51, 60, 167, 189
CviKI_1 RGCY 5 cut(s) 5, 51, 60, 167, 189
DdeI CTNAG 1 cut(s) 117
EaeI YGGCCR 2 cut(s) 49, 187
Eco88I CYCGRG 1 cut(s) 110
EcoRII CCWGG 1 cut(s) 83
FaeI CATG 2 cut(s) 94, 161
FaiI YATR 2 cut(s) 92, 159
FalI AAGNNNNNCTT 2 cut(s) 26, 58
FaqI GGGAC 1 cut(s) 191
FatI CATG 2 cut(s) 90, 157
FspI TGCGCA 1 cut(s) 95
GlaI GCGC 1 cut(s) 95
HaeIII GGCC 4 cut(s) 5, 51, 167, 189
HapII CCGG 2 cut(s) 57, 148
HhaI GCGC 1 cut(s) 96
Hin1II CATG 2 cut(s) 94, 161
Hin6I GCGC 1 cut(s) 94
HinP1I GCGC 1 cut(s) 94
HinfI GANTC 1 cut(s) 113
HpaII CCGG 2 cut(s) 57, 148
Hpy166II GTNNAC 1 cut(s) 123
Hpy188I TCNGA 2 cut(s) 16, 73
Hpy188III TCNNGA 1 cut(s) 43
Hpy8I GTNNAC 1 cut(s) 123
Hpy99I CGWCG 2 cut(s) 23, 188
HpyCH4III ACNGT 1 cut(s) 184
HpyF10VI GCNNNNNNNGC 1 cut(s) 57
HpyF3I CTNAG 1 cut(s) 117
Hsp92II CATG 2 cut(s) 94, 161
HspAI GCGC 1 cut(s) 94
LmnI GCTCC 1 cut(s) 150
LpnPI CCDG 5 cut(s) 70, 70, 97, 161, 182
MlsI TGGCCA 1 cut(s) 51
MluNI TGGCCA 1 cut(s) 51
MlyI GAGTC 1 cut(s) 122
MnlI CCTC 1 cut(s) 119
Mox20I TGGCCA 1 cut(s) 51
MscI TGGCCA 1 cut(s) 51
Msp20I TGGCCA 1 cut(s) 51
MspI CCGG 2 cut(s) 57, 148
MspR9I CCNGG 2 cut(s) 85, 148
Mva1269I GAATGC 1 cut(s) 153
MvaI CCWGG 1 cut(s) 85
MwoI GCNNNNNNNGC 1 cut(s) 57
NciI CCSGG 1 cut(s) 148
NlaIII CATG 2 cut(s) 94, 161
NsbI TGCGCA 1 cut(s) 95
PaeR7I CTCGAG 1 cut(s) 110
PctI GAATGC 1 cut(s) 153
PflFI GACNNNGTC 1 cut(s) 182
PleI GAGTC 1 cut(s) 121
PpsI GAGTC 1 cut(s) 121
Psp6I CCWGG 1 cut(s) 83
PspGI CCWGG 1 cut(s) 83
PspPI GGNCC 1 cut(s) 166
PspXI VCTCGAGB 1 cut(s) 110
PsyI GACNNNGTC 1 cut(s) 182
Sau96I GGNCC 1 cut(s) 166
SchI GAGTC 1 cut(s) 122
ScrFI CCNGG 2 cut(s) 85, 148
SetI ASST 4 cut(s) 14, 39, 89, 111
SfcI CTRYAG 1 cut(s) 7
Sfr274I CTCGAG 1 cut(s) 110
SlaI CTCGAG 1 cut(s) 110
SmlI CTYRAG 1 cut(s) 110
SmoI CTYRAG 1 cut(s) 110
StyD4I CCNGG 2 cut(s) 83, 146
TaaI ACNGT 1 cut(s) 184
TaqI TCGA 2 cut(s) 111, 135
TspDTI ATGAA 2 cut(s) 79, 146
Tth111I GACNNNGTC 1 cut(s) 182
XhoI CTCGAG 1 cut(s) 110
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.