RchiOBHm_Chr2g0132131

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0001046
Physical Location & Seq
Reverse (-)
48523118 .. 48526299
3182 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ50341

Sequence Viewer

Length: 198 bp
ATGAAGAAGAACCAACTGCCAAAGCTGGAACCTCAAGCTCAAAGTCTTCAAAAGTCTCCAAAAGAGCTGCAGCTGCAACTCCTTCAACAAGAGCTGCAGCTGCAACTCCTTCAACAAGTGCTGCTGCTGGGACCTCAAAATCTGCAAAAGCACCAAAACAAGGGCTGCTGCCACCAAGAAAACCTAAAGGATCTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

65

Amino Acids

7.56

Weight (kDa)

9.1

Isoelectric Point (pI)

89.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 160
AgsI TTSAA 3 cut(s) 50, 86, 113
AluBI AGCT 6 cut(s) 25, 38, 67, 73, 94, 100
AluI AGCT 6 cut(s) 25, 38, 67, 73, 94, 100
Alw26I GTCTC 1 cut(s) 60
AspS9I GGNCC 1 cut(s) 131
AvaII GGWCC 1 cut(s) 131
BbsI GAAGAC 1 cut(s) 38
BcoDI GTCTC 1 cut(s) 60
BfmI CTRYAG 2 cut(s) 68, 95
Bme18I GGWCC 1 cut(s) 131
BmgT120I GGNCC 1 cut(s) 131
BmiI GGNNCC 2 cut(s) 30, 132
BpiI GAAGAC 1 cut(s) 38
BpuEI CTTGAG 1 cut(s) 18
Bsc4I CCNNNNNNNGG 1 cut(s) 160
BseLI CCNNNNNNNGG 1 cut(s) 160
BseYI CCCAGC 1 cut(s) 127
BslFI GGGAC 1 cut(s) 144
BslI CCNNNNNNNGG 1 cut(s) 160
BsmAI GTCTC 1 cut(s) 60
BsmFI GGGAC 1 cut(s) 144
Bsp143I GATC 1 cut(s) 190
BspLI GGNNCC 2 cut(s) 30, 132
BspMAI CTGCAG 2 cut(s) 72, 99
BssMI GATC 1 cut(s) 190
BstKTI GATC 1 cut(s) 193
BstMAI GTCTC 1 cut(s) 60
BstMBI GATC 1 cut(s) 190
BstMWI GCNNNNNNNGC 2 cut(s) 73, 100
BstSFI CTRYAG 2 cut(s) 68, 95
BstV2I GAAGAC 1 cut(s) 38
BstX2I RGATCY 1 cut(s) 190
BstYI RGATCY 1 cut(s) 190
Cfr13I GGNCC 1 cut(s) 131
CviJI RGCY 7 cut(s) 25, 38, 67, 73, 94, 100, 165
CviKI_1 RGCY 7 cut(s) 25, 38, 67, 73, 94, 100, 165
DpnI GATC 1 cut(s) 192
DpnII GATC 1 cut(s) 190
Eco47I GGWCC 1 cut(s) 131
EcoO109I RGGNCCY 1 cut(s) 131
FaqI GGGAC 1 cut(s) 144
GsaI CCCAGC 1 cut(s) 131
Hpy188I TCNGA 1 cut(s) 197
HpyAV CCTTC 2 cut(s) 92, 119
HpyCH4V TGCA 5 cut(s) 70, 76, 97, 103, 145
HpyF10VI GCNNNNNNNGC 2 cut(s) 73, 100
Kzo9I GATC 1 cut(s) 190
LpnPI CCDG 2 cut(s) 11, 113
MalI GATC 1 cut(s) 192
MboI GATC 1 cut(s) 190
MboII GAAGA 3 cut(s) 16, 19, 38
MflI RGATCY 1 cut(s) 190
MnlI CCTC 2 cut(s) 42, 144
MspA1I CMGCKG 2 cut(s) 73, 100
MwoI GCNNNNNNNGC 2 cut(s) 73, 100
NdeII GATC 1 cut(s) 190
NlaIV GGNNCC 2 cut(s) 30, 132
PpuMI RGGWCCY 1 cut(s) 131
Psp5II RGGWCCY 1 cut(s) 131
PspFI CCCAGC 1 cut(s) 127
PspN4I GGNNCC 2 cut(s) 30, 132
PspPI GGNCC 1 cut(s) 131
PspPPI RGGWCCY 1 cut(s) 131
PstI CTGCAG 2 cut(s) 72, 99
PsuI RGATCY 1 cut(s) 190
PvuII CAGCTG 2 cut(s) 73, 100
Sau3AI GATC 1 cut(s) 190
Sau96I GGNCC 1 cut(s) 131
SetI ASST 9 cut(s) 27, 34, 40, 69, 75, 96, 102, 136, 186
SfcI CTRYAG 2 cut(s) 68, 95
SgeI CNNG 7 cut(s) 38, 47, 101, 128, 140, 172, 188
SinI GGWCC 1 cut(s) 131
SmlI CTYRAG 1 cut(s) 33
SmoI CTYRAG 1 cut(s) 33
TspDTI ATGAA 1 cut(s) 17
VpaK11BI GGWCC 1 cut(s) 131
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.