RchiOBHm_Chr4g0395691

Ras-related protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
11511203 .. 11511477
275 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 231 bp
ATGACGACAAGGCCCTCGACCTCTTCATCTCCAATCGGAAAGTCTCTCCGGCTCTTCGACATGGTCTACAGGTCGCATGACGACTACCACTTCAAGGTCGTATTGATCAGCGATTCCGACATCGACAAATCTGATTTGTTGTCCAGGTTCATGCGCAACGAGTTCAACCTCGTGTCTAACTCCACCATTGGTGTCGAGTTTGCCACCTGGAGCATCCATGTCGATGATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

76

Amino Acids

8.73

Weight (kDa)

5.42

Isoelectric Point (pI)

30.43

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ras PF00071 32 - 75 1.7e-07 Ras family
Roc PF08477 32 - 73 1.8e-06 Ras of Complex, Roc, domain of DAPkinase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 155
AccI GTMKAC 1 cut(s) 66
AfiI CCNNNNNNNGG 1 cut(s) 94
AgsI TTSAA 2 cut(s) 94, 166
AjnI CCWGG 2 cut(s) 143, 206
Alw26I GTCTC 1 cut(s) 48
AoxI GGCC 1 cut(s) 11
AspLEI GCGC 1 cut(s) 156
AspS9I GGNCC 1 cut(s) 12
BauI CACGAG 1 cut(s) 170
BcgI CGANNNNNNTGC 1 cut(s) 202
BciT130I CCWGG 2 cut(s) 145, 208
BclI TGATCA 1 cut(s) 105
BcoDI GTCTC 1 cut(s) 48
BfmI CTRYAG 1 cut(s) 67
Bme1390I CCNGG 2 cut(s) 145, 208
BmgT120I GGNCC 1 cut(s) 12
BmrFI CCNGG 2 cut(s) 145, 208
BmsI GCATC 1 cut(s) 222
BpmI CTGGAG 1 cut(s) 229
Bsc4I CCNNNNNNNGG 1 cut(s) 94
BseBI CCWGG 2 cut(s) 145, 208
BseGI GGATG 1 cut(s) 213
BseLI CCNNNNNNNGG 1 cut(s) 94
BshFI GGCC 1 cut(s) 13
BsiSI CCGG 1 cut(s) 49
BslI CCNNNNNNNGG 1 cut(s) 94
BsmAI GTCTC 1 cut(s) 48
BsnI GGCC 1 cut(s) 13
Bsp143I GATC 1 cut(s) 105
BspANI GGCC 1 cut(s) 13
BspQI GCTCTTC 1 cut(s) 59
BssMI GATC 1 cut(s) 105
BssSI CACGAG 1 cut(s) 170
Bst2BI CACGAG 1 cut(s) 170
Bst2UI CCWGG 2 cut(s) 145, 208
Bst6I CTCTTC 2 cut(s) 28, 59
BstF5I GGATG 1 cut(s) 213
BstHHI GCGC 1 cut(s) 156
BstKTI GATC 1 cut(s) 108
BstMAI GTCTC 1 cut(s) 48
BstMBI GATC 1 cut(s) 105
BstNI CCWGG 2 cut(s) 145, 208
BstSCI CCNGG 2 cut(s) 143, 206
BstSFI CTRYAG 1 cut(s) 67
BsuRI GGCC 1 cut(s) 13
BtsCI GGATG 1 cut(s) 213
CfoI GCGC 1 cut(s) 156
Cfr13I GGNCC 1 cut(s) 12
CviAII CATG 4 cut(s) 61, 77, 151, 218
CviJI RGCY 2 cut(s) 13, 52
CviKI_1 RGCY 2 cut(s) 13, 52
DpnI GATC 1 cut(s) 107
DpnII GATC 1 cut(s) 105
Eam1104I CTCTTC 2 cut(s) 28, 59
EarI CTCTTC 2 cut(s) 28, 59
EcoO109I RGGNCCY 1 cut(s) 12
EcoRII CCWGG 2 cut(s) 143, 206
FaeI CATG 4 cut(s) 64, 80, 154, 221
FaiI YATR 4 cut(s) 62, 78, 152, 219
FatI CATG 4 cut(s) 60, 76, 150, 217
FbaI TGATCA 1 cut(s) 105
FblI GTMKAC 1 cut(s) 66
FokI GGATG 1 cut(s) 200
FspI TGCGCA 1 cut(s) 155
GlaI GCGC 1 cut(s) 155
GsuI CTGGAG 1 cut(s) 229
HaeIII GGCC 1 cut(s) 13
HapII CCGG 1 cut(s) 49
HhaI GCGC 1 cut(s) 156
Hin1II CATG 4 cut(s) 64, 80, 154, 221
Hin6I GCGC 1 cut(s) 154
HinP1I GCGC 1 cut(s) 154
HinfI GANTC 1 cut(s) 113
HpaII CCGG 1 cut(s) 49
Hpy166II GTNNAC 1 cut(s) 67
Hpy188I TCNGA 3 cut(s) 38, 118, 133
Hpy8I GTNNAC 1 cut(s) 67
Hsp92II CATG 4 cut(s) 64, 80, 154, 221
HspAI GCGC 1 cut(s) 154
Ksp22I TGATCA 1 cut(s) 105
Kzo9I GATC 1 cut(s) 105
LguI GCTCTTC 1 cut(s) 59
LmnI GCTCC 1 cut(s) 210
LpnPI CCDG 6 cut(s) 55, 62, 130, 157, 193, 220
LweI GCATC 1 cut(s) 222
MalI GATC 1 cut(s) 107
MboI GATC 1 cut(s) 105
MboII GAAGA 2 cut(s) 15, 46
MmeI TCCRAC 1 cut(s) 141
MnlI CCTC 3 cut(s) 25, 31, 179
MslI CAYNNNNRTG 1 cut(s) 222
MspI CCGG 1 cut(s) 49
MspR9I CCNGG 2 cut(s) 145, 208
MvaI CCWGG 2 cut(s) 145, 208
NdeII GATC 1 cut(s) 105
NlaIII CATG 4 cut(s) 64, 80, 154, 221
NsbI TGCGCA 1 cut(s) 155
PciSI GCTCTTC 1 cut(s) 59
PfeI GAWTC 1 cut(s) 113
PflFI GACNNNGTC 1 cut(s) 62
Psp6I CCWGG 2 cut(s) 143, 206
PspGI CCWGG 2 cut(s) 143, 206
PspPI GGNCC 1 cut(s) 12
PsyI GACNNNGTC 1 cut(s) 62
RseI CAYNNNNRTG 1 cut(s) 222
SapI GCTCTTC 1 cut(s) 59
Sau3AI GATC 1 cut(s) 105
Sau96I GGNCC 1 cut(s) 12
ScrFI CCNGG 2 cut(s) 145, 208
SetI ASST 6 cut(s) 23, 74, 99, 149, 171, 209
SfaNI GCATC 1 cut(s) 222
SfcI CTRYAG 1 cut(s) 67
SmiMI CAYNNNNRTG 1 cut(s) 222
StyD4I CCNGG 2 cut(s) 143, 206
TaqI TCGA 5 cut(s) 17, 57, 123, 195, 222
TfiI GAWTC 1 cut(s) 113
TspDTI ATGAA 2 cut(s) 15, 139
Tth111I GACNNNGTC 1 cut(s) 62
XmiI GTMKAC 1 cut(s) 66
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.