RchiOBHm_Chr2g0155351

Phosphoenolpyruvate carboxylase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
72243948 .. 72244367
420 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ52424

Sequence Viewer

Length: 192 bp
ATGGATAAGCATGACCTAGTTGTCACAAAAAATGTCTCGCTTTTATCTAGGTGGATGACTATTGATCTCTATATTAGAGAAGTGGATAGCCTGAAATTTGAACTATCCATGAATTGGTGCAGTAATAGCTTGTCAAAACTGGCACAAGAGATTCTAGAGCACAGTATGACATATTGCAGTTATTTTCAGTGA

Protein Analysis

63

Amino Acids

7.49

Weight (kDa)

5.47

Isoelectric Point (pI)

26.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 20
AccB7I CCANNNNNTGG 1 cut(s) 114
AcsI RAATTY 1 cut(s) 95
AfiI CCNNNNNNNGG 1 cut(s) 114
AgsI TTSAA 1 cut(s) 101
AluBI AGCT 1 cut(s) 129
AluI AGCT 1 cut(s) 129
Alw21I GWGCWC 1 cut(s) 162
Alw26I GTCTC 1 cut(s) 40
ApoI RAATTY 1 cut(s) 95
Bbv12I GWGCWC 1 cut(s) 162
BcoDI GTCTC 1 cut(s) 40
BfaI CTAG 3 cut(s) 17, 48, 155
Bsc4I CCNNNNNNNGG 1 cut(s) 114
Bse1I ACTGG 1 cut(s) 144
BseGI GGATG 1 cut(s) 60
BseLI CCNNNNNNNGG 1 cut(s) 114
BseNI ACTGG 1 cut(s) 144
BsgI GTGCAG 1 cut(s) 139
BsiHKAI GWGCWC 1 cut(s) 162
BslI CCNNNNNNNGG 1 cut(s) 114
BsmAI GTCTC 1 cut(s) 40
Bsp1286I GDGCHC 1 cut(s) 162
Bsp143I GATC 1 cut(s) 64
BsrI ACTGG 1 cut(s) 144
BssMI GATC 1 cut(s) 64
Bst4CI ACNGT 1 cut(s) 164
BstF5I GGATG 1 cut(s) 60
BstKTI GATC 1 cut(s) 67
BstMAI GTCTC 1 cut(s) 40
BstMBI GATC 1 cut(s) 64
BstMWI GCNNNNNNNGC 1 cut(s) 126
BtsCI GGATG 1 cut(s) 60
CviAII CATG 2 cut(s) 11, 109
CviJI RGCY 2 cut(s) 90, 129
CviKI_1 RGCY 2 cut(s) 90, 129
DpnI GATC 1 cut(s) 66
DpnII GATC 1 cut(s) 64
DrdI GACNNNNNNGTC 1 cut(s) 20
DseDI GACNNNNNNGTC 1 cut(s) 20
FaeI CATG 2 cut(s) 14, 112
FaiI YATR 5 cut(s) 12, 72, 110, 167, 172
FatI CATG 2 cut(s) 10, 108
FokI GGATG 1 cut(s) 67
FspBI CTAG 3 cut(s) 17, 48, 155
FspEI CC 8 cut(s) 29, 34, 37, 68, 100, 104, 121, 125
Hin1II CATG 2 cut(s) 14, 112
HinfI GANTC 1 cut(s) 151
Hpy188III TCNNGA 1 cut(s) 155
HpyCH4III ACNGT 1 cut(s) 164
HpyCH4V TGCA 2 cut(s) 120, 177
HpyF10VI GCNNNNNNNGC 1 cut(s) 126
Hsp92II CATG 2 cut(s) 14, 112
Kzo9I GATC 1 cut(s) 64
LpnPI CCDG 2 cut(s) 104, 125
MaeI CTAG 3 cut(s) 17, 48, 155
MaeIII GTNAC 1 cut(s) 22
MalI GATC 1 cut(s) 66
MboI GATC 1 cut(s) 64
MhlI GDGCHC 1 cut(s) 162
MluCI AATT 2 cut(s) 95, 112
MwoI GCNNNNNNNGC 1 cut(s) 126
NdeII GATC 1 cut(s) 64
NlaIII CATG 2 cut(s) 14, 112
NmuCI GTSAC 1 cut(s) 22
PfeI GAWTC 1 cut(s) 151
PflMI CCANNNNNTGG 1 cut(s) 114
Sau3AI GATC 1 cut(s) 64
SduI GDGCHC 1 cut(s) 162
SetI ASST 3 cut(s) 18, 53, 131
Sse9I AATT 2 cut(s) 95, 112
SspMI CTAG 3 cut(s) 17, 48, 155
TaaI ACNGT 1 cut(s) 164
TasI AATT 2 cut(s) 95, 112
TfiI GAWTC 1 cut(s) 151
TseFI GTSAC 1 cut(s) 22
Tsp45I GTSAC 1 cut(s) 22
TspDTI ATGAA 1 cut(s) 125
Van91I CCANNNNNTGG 1 cut(s) 114
XapI RAATTY 1 cut(s) 95
XbaI TCTAGA 1 cut(s) 154
XspI CTAG 3 cut(s) 17, 48, 155
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.