Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002935.1

Orthogroup ID

OG0001048

Physical Location & Seq

Genomic Coordinates Forward (+)

76709 .. 79390

Gene Structure 2682 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002935.1_g000015.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 516 bp

atgcaggacacggcagagctgctggagaagaagctagcgttggaaatttcgaagatgagcttagaggaggcactcactctcgctcgtgctttcagccattacctcaatttgttgggcattgctgaagctcatcacaggatgttgaacattatgattaaaagacatgttgaaaatttgtttagactaataatatcaagttacttgcagcgtcttttaaatttaagagaccgacctgatcttactagtgaagacagagatatggtgattgaagacctggtgcgagagataacttctgtatggcaaatagatgagcttaggcaccataaacccacaccaggtgatgaagctagggcagaatctgcatataaggatcaccagagttgggatcatcagtgttataataggaatatggtaaagcaacgagctgcagcacttccaacacaacttccagctagagctgatcaaccctcttgcactggtgaacatccgattatcctcttaagactacttttttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004611 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0006082 GO:0006091 GO:0006099 GO:0006101 GO:0008150 GO:0008152 GO:0008964 GO:0009060 GO:0009987 GO:0015980 GO:0016829 GO:0016830 GO:0016831 GO:0016999 GO:0017144 GO:0019752 GO:0043436 GO:0044237 GO:0044238 GO:0044281 GO:0044424 GO:0044444 GO:0044464 GO:0045333 GO:0055114 GO:0071704 GO:0072350

KEGG Pathways

Metabolic & Signaling

ko00620 ko00680 ko00710 ko00720 ko01100 ko01120 ko01200 map00620 map00680 map00710 map00720 map01100 map01120 map01200

Pfam Domains

Protein Families

PEPcase

Protein Analysis

171

Amino Acids

19.91

Weight (kDa)

6.3

Isoelectric Point (pI)

52.08

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001048)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr1g0330341 RchiOBHm_Chr1g0336151 RchiOBHm_Chr1g0355571 RchiOBHm_Chr1g0379921 RchiOBHm_Chr2g0118311 RchiOBHm_Chr2g0135891 RchiOBHm_Chr2g0155351 RchiOBHm_Chr2g0155371 RchiOBHm_Chr4g0394861 RchiOBHm_Chr4g0407121 RchiOBHm_Chr5g0035481 RchiOBHm_Chr5g0035671 RchiOBHm_Chr5g0035831 RchiOBHm_Chr5g0063711 RchiOBHm_Chr6g0312321 RchiOBHm_Chr7g0200221
rosa_laevigata	RLG00000009003 RLG00000018408 RLG00000023915 RLG00000026351
rosa_multiflora	Rmu_co8334137.1_g000001 Rmu_sc0000084.1_g000018 Rmu_sc0002935.1_g000015 Rmu_sc0004184.1_g000022 Rmu_sc0004305.1_g000014 Rmu_sc0004950.1_g000010 Rmu_sc0005795.1_g000005 Rmu_sc0011378.1_g000001
rosa_roxburghii	Rroxscaffold_1G00009990 Rroxscaffold_1G00028430 Rroxscaffold_1G00037070 Rroxscaffold_2G00090780 Rroxscaffold_2G00125020 Rroxscaffold_2G00125690 Rroxscaffold_3G00252090 Rroxscaffold_6G00393900
rosa_rugosa	Rorug03G0293900 Rorug03G0334700 Rorug03G0343100 Rorug04G0385500 Rorug05G0136700 Rorug06G0008200
rosa_samantha	Rh1BG396000 Rh1CG409000 Rh2CG325300 Rh4AG142900 Rh4AG276000 Rh5CG272500 Rh5CG276700 Rh6BG126600 Rh6DG111600
rosa_wichuraiana	Rw2G011210 Rw3G012340 Rw3G019470 Rw4G034300 Rw5G010750 Rw5G022370 Rw5G022390 Rw5G022420 Rw6G007260 Rw7G036970

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	399
AccB1I	GGYRCC	1 cut(s)	318
AclWI	GGATC	2 cut(s)	378, 393
AcsI	RAATTY	3 cut(s)	45, 172, 217
AcuI	CTGAAG	1 cut(s)	144
AdeI	CACNNNGTG	1 cut(s)	338
AfiI	CCNNNNNNNGG	2 cut(s)	335, 382
AflII	CTTAAG	1 cut(s)	499
AflIII	ACRYGT	1 cut(s)	163
AgsI	TTSAA	3 cut(s)	145, 170, 269
AhlI	ACTAGT	1 cut(s)	242
AjnI	CCWGG	2 cut(s)	273, 334
AjuI	GAANNNNNNNTTGG	2 cut(s)	23, 55
AluBI	AGCT	9 cut(s)	19, 34, 60, 128, 313, 347, 425, 452, 458
AluI	AGCT	9 cut(s)	19, 34, 60, 128, 313, 347, 425, 452, 458
Alw26I	GTCTC	1 cut(s)	219
AlwI	GGATC	2 cut(s)	378, 393
AlwNI	CAGNNNCTG	1 cut(s)	359
ApeKI	GCWGC	4 cut(s)	19, 205, 425, 428
ApoI	RAATTY	3 cut(s)	45, 172, 217
AsuHPI	GGTGA	4 cut(s)	274, 350, 365, 491
AsuII	TTCGAA	1 cut(s)	50
AsuNHI	GCTAGC	1 cut(s)	34
BanI	GGYRCC	1 cut(s)	318
BauI	CACGAG	1 cut(s)	84
BbsI	GAAGAC	2 cut(s)	255, 276
BbvI	GCAGC	4 cut(s)	6, 217, 412, 440
BceAI	ACGGC	1 cut(s)	27
BciT130I	CCWGG	2 cut(s)	275, 336
BclI	TGATCA	1 cut(s)	460
BcoDI	GTCTC	1 cut(s)	219
BcuI	ACTAGT	1 cut(s)	242
BfaI	CTAG	4 cut(s)	35, 243, 348, 453
BfmI	CTRYAG	1 cut(s)	426
BfrI	CTTAAG	1 cut(s)	499
BisI	GCNGC	4 cut(s)	20, 206, 426, 429
BlsI	GCNGC	4 cut(s)	21, 207, 427, 430
Bme1390I	CCNGG	2 cut(s)	275, 336
BmiI	GGNNCC	1 cut(s)	320
BmrFI	CCNGG	2 cut(s)	275, 336
BmtI	GCTAGC	1 cut(s)	38
BpiI	GAAGAC	2 cut(s)	255, 276
BpmI	CTGGAG	1 cut(s)	44
Bpu10I	CCTNAGC	1 cut(s)	314
Bpu14I	TTCGAA	1 cut(s)	50
BsaI	GGTCTC	1 cut(s)	219
Bsc4I	CCNNNNNNNGG	2 cut(s)	335, 382
Bse1I	ACTGG	1 cut(s)	481
Bse3DI	GCAATG	1 cut(s)	117
BseBI	CCWGG	2 cut(s)	275, 336
BseGI	GGATG	2 cut(s)	144, 484
BseLI	CCNNNNNNNGG	2 cut(s)	335, 382
BseMI	GCAATG	1 cut(s)	117
BseNI	ACTGG	1 cut(s)	481
BseRI	GAGGAG	1 cut(s)	80
BseXI	GCAGC	4 cut(s)	6, 217, 412, 440
BshNI	GGYRCC	1 cut(s)	318
BslI	CCNNNNNNNGG	2 cut(s)	335, 382
BsmAI	GTCTC	1 cut(s)	219
Bso31I	GGTCTC	1 cut(s)	219
Bsp119I	TTCGAA	1 cut(s)	50
Bsp143I	GATC	4 cut(s)	235, 370, 385, 460
BspLI	GGNNCC	1 cut(s)	320
BspMAI	CTGCAG	1 cut(s)	430
BspOI	GCTAGC	1 cut(s)	38
BspPI	GGATC	2 cut(s)	378, 393
BspT104I	TTCGAA	1 cut(s)	50
BspT107I	GGYRCC	1 cut(s)	318
BspTI	CTTAAG	1 cut(s)	499
BspTNI	GGTCTC	1 cut(s)	219
BsrDI	GCAATG	1 cut(s)	117
BsrI	ACTGG	1 cut(s)	481
BssMI	GATC	4 cut(s)	235, 370, 385, 460
BssSI	CACGAG	1 cut(s)	84
Bst2BI	CACGAG	1 cut(s)	84
Bst2UI	CCWGG	2 cut(s)	275, 336
BstAFI	CTTAAG	1 cut(s)	499
BstAPI	GCANNNNNTGC	1 cut(s)	359
BstBI	TTCGAA	1 cut(s)	50
BstC8I	GCNNGC	1 cut(s)	36
BstDEI	CTNAG	2 cut(s)	61, 314
BstF5I	GGATG	2 cut(s)	144, 484
BstKTI	GATC	4 cut(s)	238, 373, 388, 463
BstMAI	GTCTC	1 cut(s)	219
BstMBI	GATC	4 cut(s)	235, 370, 385, 460
BstMWI	GCNNNNNNNGC	1 cut(s)	359
BstNI	CCWGG	2 cut(s)	275, 336
BstNSI	RCATGY	1 cut(s)	167
BstSCI	CCNGG	2 cut(s)	273, 334
BstSFI	CTRYAG	1 cut(s)	426
BstV1I	GCAGC	4 cut(s)	6, 217, 412, 440
BstV2I	GAAGAC	2 cut(s)	255, 276
BtsCI	GGATG	2 cut(s)	144, 484
BtsIMutI	CAGTG	2 cut(s)	398, 474
Cac8I	GCNNGC	1 cut(s)	36
CaiI	CAGNNNCTG	1 cut(s)	359
CseI	GACGC	1 cut(s)	197
CsiI	ACCWGGT	2 cut(s)	273, 334
CviAII	CATG	1 cut(s)	164
DdeI	CTNAG	2 cut(s)	61, 314
DpnI	GATC	4 cut(s)	237, 372, 387, 462
DpnII	GATC	4 cut(s)	235, 370, 385, 460
DraI	TTTAAA	1 cut(s)	216
DraIII	CACNNNGTG	1 cut(s)	338
Eco31I	GGTCTC	1 cut(s)	219
Eco57I	CTGAAG	1 cut(s)	144
EcoRII	CCWGG	2 cut(s)	273, 334
FaeI	CATG	1 cut(s)	167
FaiI	YATR	9 cut(s)	152, 165, 260, 298, 324, 364, 366, 399, 410
FalI	AAGNNNNNCTT	2 cut(s)	44, 76
FatI	CATG	1 cut(s)	163
FbaI	TGATCA	1 cut(s)	460
Fnu4HI	GCNGC	4 cut(s)	20, 206, 426, 429
FokI	GGATG	2 cut(s)	151, 471
Fsp4HI	GCNGC	4 cut(s)	20, 206, 426, 429
FspBI	CTAG	4 cut(s)	35, 243, 348, 453
GluI	GCNGC	4 cut(s)	20, 206, 426, 429
GsuI	CTGGAG	1 cut(s)	44
HgaI	GACGC	1 cut(s)	197
Hin1II	CATG	1 cut(s)	167
HinfI	GANTC	1 cut(s)	356
HphI	GGTGA	4 cut(s)	274, 350, 365, 491
Hpy166II	GTNNAC	1 cut(s)	482
Hpy188I	TCNGA	1 cut(s)	489
Hpy8I	GTNNAC	1 cut(s)	482
HpyCH4V	TGCA	5 cut(s)	4, 205, 362, 428, 474
HpyF10VI	GCNNNNNNNGC	1 cut(s)	359
HpyF3I	CTNAG	2 cut(s)	61, 314
Hsp92II	CATG	1 cut(s)	167
Ksp22I	TGATCA	1 cut(s)	460
Kzo9I	GATC	4 cut(s)	235, 370, 385, 460
Lsp1109I	GCAGC	4 cut(s)	6, 217, 412, 440
MabI	ACCWGGT	2 cut(s)	273, 334
MaeI	CTAG	4 cut(s)	35, 243, 348, 453
MaeIII	GTNAC	1 cut(s)	197
MalI	GATC	4 cut(s)	237, 372, 387, 462
MboI	GATC	4 cut(s)	235, 370, 385, 460
MboII	GAAGA	4 cut(s)	40, 64, 260, 281
MluCI	AATT	4 cut(s)	45, 106, 172, 217
MmeI	TCCRAC	2 cut(s)	21, 461
MnlI	CCTC	5 cut(s)	58, 61, 113, 478, 506
MseI	TTAA	5 cut(s)	156, 215, 221, 500, 514
MspCI	CTTAAG	1 cut(s)	499
MspR9I	CCNGG	2 cut(s)	275, 336
MvaI	CCWGG	2 cut(s)	275, 336
MwoI	GCNNNNNNNGC	1 cut(s)	359
NdeII	GATC	4 cut(s)	235, 370, 385, 460
NheI	GCTAGC	1 cut(s)	34
NlaIII	CATG	1 cut(s)	167
NlaIV	GGNNCC	1 cut(s)	320
NspI	RCATGY	1 cut(s)	167
NspV	TTCGAA	1 cut(s)	50
PciI	ACATGT	1 cut(s)	163
PfeI	GAWTC	1 cut(s)	356
PkrI	GCNGC	4 cut(s)	21, 207, 427, 430
PscI	ACATGT	1 cut(s)	163
PsiI	TTATAA	1 cut(s)	399
Psp6I	CCWGG	2 cut(s)	273, 334
PspGI	CCWGG	2 cut(s)	273, 334
PspN4I	GGNNCC	1 cut(s)	320
PstI	CTGCAG	1 cut(s)	430
PstNI	CAGNNNCTG	1 cut(s)	359
SaqAI	TTAA	5 cut(s)	156, 215, 221, 500, 514
SatI	GCNGC	4 cut(s)	20, 206, 426, 429
Sau3AI	GATC	4 cut(s)	235, 370, 385, 460
ScrFI	CCNGG	2 cut(s)	275, 336
SexAI	ACCWGGT	2 cut(s)	273, 334
SfcI	CTRYAG	1 cut(s)	426
SfuI	TTCGAA	1 cut(s)	50
SmlI	CTYRAG	1 cut(s)	499
SmoI	CTYRAG	1 cut(s)	499
SpeI	ACTAGT	1 cut(s)	242
Sse9I	AATT	4 cut(s)	45, 106, 172, 217
SspMI	CTAG	4 cut(s)	35, 243, 348, 453
StyD4I	CCNGG	2 cut(s)	273, 334
TaqI	TCGA	1 cut(s)	50
TaqII	GACCGA	1 cut(s)	243
TasI	AATT	4 cut(s)	45, 106, 172, 217
TfiI	GAWTC	1 cut(s)	356
Tru1I	TTAA	5 cut(s)	156, 215, 221, 500, 514
Tru9I	TTAA	5 cut(s)	156, 215, 221, 500, 514
TscAI	CASTG	2 cut(s)	398, 481
TseI	GCWGC	4 cut(s)	19, 205, 425, 428
TspDTI	ATGAA	1 cut(s)	357
TspRI	CASTG	2 cut(s)	398, 481
Vha464I	CTTAAG	1 cut(s)	499
XapI	RAATTY	3 cut(s)	45, 172, 217
XceI	RCATGY	1 cut(s)	167
XspI	CTAG	4 cut(s)	35, 243, 348, 453

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.