Rmu_sc0004184.1_g000022

Phosphoenolpyruvate carboxylase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004184.1
Physical Location & Seq
Forward (+)
93815 .. 95445
1631 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004184.1_g000022.1.cds

Sequence Viewer

Length: 372 bp
atgagcttagaggaggcactcactcttgctcgtgttttcagccgttacctcaatttgatgggcattgctgaagttcatcacagggttcatagacaaaagaatgtggcatccctatcaaaatcttgtgatgatatttttaatcagcttctgcagcgtgatgtttccccagaccacctttacgataccgtgcgagagataacttctgtatggcaaacagatgagcttaggcactataaacccacaccagttgatgaagctagggcagcacactgggaaactggaaaaccacttccgttgaaatgcacaccaatcaggtttggctcttggatggggggtggtcgagatggaaatcccaatgtcacagcaaactga

Protein Analysis

123

Amino Acids

14.01

Weight (kDa)

7.01

Isoelectric Point (pI)

38.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 90
AgsI TTSAA 1 cut(s) 298
AluBI AGCT 4 cut(s) 6, 145, 223, 257
AluI AGCT 4 cut(s) 6, 145, 223, 257
AlwNI CAGNNNCTG 1 cut(s) 148
ApeKI GCWGC 2 cut(s) 151, 263
BauI CACGAG 1 cut(s) 30
BbvI GCAGC 2 cut(s) 163, 275
BccI CCATC 3 cut(s) 52, 322, 338
BceAI ACGGC 1 cut(s) 27
BfaI CTAG 1 cut(s) 258
BfmI CTRYAG 1 cut(s) 149
BisI GCNGC 2 cut(s) 152, 264
BlsI GCNGC 2 cut(s) 153, 265
BmrI ACTGGG 1 cut(s) 280
BmsI GCATC 1 cut(s) 116
BmuI ACTGGG 1 cut(s) 280
Bpu10I CCTNAGC 1 cut(s) 224
BsaBI GATNNNNATC 1 cut(s) 348
Bse1I ACTGG 3 cut(s) 245, 275, 283
Bse3DI GCAATG 1 cut(s) 63
Bse8I GATNNNNATC 1 cut(s) 348
BseGI GGATG 2 cut(s) 107, 333
BseJI GATNNNNATC 1 cut(s) 348
BseMI GCAATG 1 cut(s) 63
BseNI ACTGG 3 cut(s) 245, 275, 283
BseRI GAGGAG 1 cut(s) 26
BseXI GCAGC 2 cut(s) 163, 275
BspMAI CTGCAG 1 cut(s) 153
BsrDI GCAATG 1 cut(s) 63
BsrI ACTGG 3 cut(s) 245, 275, 283
BssSI CACGAG 1 cut(s) 30
Bst2BI CACGAG 1 cut(s) 30
Bst4CI ACNGT 1 cut(s) 187
BstDEI CTNAG 2 cut(s) 7, 224
BstF5I GGATG 2 cut(s) 107, 333
BstMWI GCNNNNNNNGC 2 cut(s) 151, 263
BstSFI CTRYAG 1 cut(s) 149
BstV1I GCAGC 2 cut(s) 163, 275
BtsCI GGATG 2 cut(s) 107, 333
BtsIMutI CAGTG 1 cut(s) 268
CaiI CAGNNNCTG 1 cut(s) 148
CspCI CAANNNNNGTGG 4 cut(s) 229, 264, 276, 311
CviJI RGCY 6 cut(s) 6, 42, 145, 223, 257, 321
CviKI_1 RGCY 6 cut(s) 6, 42, 145, 223, 257, 321
DdeI CTNAG 2 cut(s) 7, 224
Eco57I CTGAAG 1 cut(s) 90
FaiI YATR 3 cut(s) 90, 208, 234
Fnu4HI GCNGC 2 cut(s) 152, 264
FokI GGATG 2 cut(s) 94, 340
Fsp4HI GCNGC 2 cut(s) 152, 264
FspBI CTAG 1 cut(s) 258
GluI GCNGC 2 cut(s) 152, 264
Hpy188III TCNNGA 1 cut(s) 341
HpyCH4III ACNGT 1 cut(s) 187
HpyCH4V TGCA 2 cut(s) 151, 303
HpyF10VI GCNNNNNNNGC 2 cut(s) 151, 263
HpyF3I CTNAG 2 cut(s) 7, 224
LpnPI CCDG 6 cut(s) 67, 180, 256, 258, 264, 298
Lsp1109I GCAGC 2 cut(s) 163, 275
LweI GCATC 1 cut(s) 116
MaeI CTAG 1 cut(s) 258
MaeIII GTNAC 2 cut(s) 44, 358
MluCI AATT 1 cut(s) 52
MnlI CCTC 3 cut(s) 4, 7, 59
MseI TTAA 1 cut(s) 138
MwoI GCNNNNNNNGC 2 cut(s) 151, 263
NmuCI GTSAC 1 cut(s) 358
PkrI GCNGC 2 cut(s) 153, 265
PstI CTGCAG 1 cut(s) 153
PstNI CAGNNNCTG 1 cut(s) 148
SaqAI TTAA 1 cut(s) 138
SatI GCNGC 2 cut(s) 152, 264
SetI ASST 7 cut(s) 8, 51, 147, 177, 225, 259, 317
SfaNI GCATC 1 cut(s) 116
SfcI CTRYAG 1 cut(s) 149
Sse9I AATT 1 cut(s) 52
SspMI CTAG 1 cut(s) 258
TaaI ACNGT 1 cut(s) 187
TaqI TCGA 1 cut(s) 340
TasI AATT 1 cut(s) 52
Tru1I TTAA 1 cut(s) 138
Tru9I TTAA 1 cut(s) 138
TscAI CASTG 1 cut(s) 275
TseFI GTSAC 1 cut(s) 358
TseI GCWGC 2 cut(s) 151, 263
Tsp45I GTSAC 1 cut(s) 358
TspDTI ATGAA 3 cut(s) 65, 77, 267
TspGWI ACGGA 1 cut(s) 282
TspRI CASTG 1 cut(s) 275
XspI CTAG 1 cut(s) 258
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.