Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000084.1

Orthogroup ID

OG0001048

Physical Location & Seq

Genomic Coordinates Forward (+)

56579 .. 57199

Gene Structure 621 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000084.1_g000018.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 297 bp

atggcggggatggatgacacggcggagctgctggaggcgtcgaaaattttgaagatgagcttagagaaggcactcactctcgctcgtgctttcagccattacctcaattggatgggcattgctgaagctcatcacagggttcgtagacaaaagaatgtggcatcccgatcaaaatcttgtgatgatatttttaatcagcttctgcagcgtggtgtttccccagaccagctttacgataccatttgcaagcaggttggttcttttccttctatcctttgtcttgatttgtatgcctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004611 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0006082 GO:0006091 GO:0006099 GO:0006101 GO:0008150 GO:0008152 GO:0008964 GO:0009060 GO:0009987 GO:0015980 GO:0016829 GO:0016830 GO:0016831 GO:0016999 GO:0017144 GO:0019752 GO:0043436 GO:0044237 GO:0044238 GO:0044281 GO:0044424 GO:0044444 GO:0044464 GO:0045333 GO:0055114 GO:0071704 GO:0072350

KEGG Pathways

Metabolic & Signaling

ko00620 ko00680 ko00710 ko00720 ko01100 ko01120 ko01200 map00620 map00680 map00710 map00720 map01100 map01120 map01200

Pfam Domains

Protein Families

PEPcase

Protein Analysis

98

Amino Acids

11.05

Weight (kDa)

7.74

Isoelectric Point (pI)

58.67

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001048)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr1g0330341 RchiOBHm_Chr1g0336151 RchiOBHm_Chr1g0355571 RchiOBHm_Chr1g0379921 RchiOBHm_Chr2g0118311 RchiOBHm_Chr2g0135891 RchiOBHm_Chr2g0155351 RchiOBHm_Chr2g0155371 RchiOBHm_Chr4g0394861 RchiOBHm_Chr4g0407121 RchiOBHm_Chr5g0035481 RchiOBHm_Chr5g0035671 RchiOBHm_Chr5g0035831 RchiOBHm_Chr5g0063711 RchiOBHm_Chr6g0312321 RchiOBHm_Chr7g0200221
rosa_laevigata	RLG00000009003 RLG00000018408 RLG00000023915 RLG00000026351
rosa_multiflora	Rmu_co8334137.1_g000001 Rmu_sc0000084.1_g000018 Rmu_sc0002935.1_g000015 Rmu_sc0004184.1_g000022 Rmu_sc0004305.1_g000014 Rmu_sc0004950.1_g000010 Rmu_sc0005795.1_g000005 Rmu_sc0011378.1_g000001
rosa_roxburghii	Rroxscaffold_1G00009990 Rroxscaffold_1G00028430 Rroxscaffold_1G00037070 Rroxscaffold_2G00090780 Rroxscaffold_2G00125020 Rroxscaffold_2G00125690 Rroxscaffold_3G00252090 Rroxscaffold_6G00393900
rosa_rugosa	Rorug03G0293900 Rorug03G0334700 Rorug03G0343100 Rorug04G0385500 Rorug05G0136700 Rorug06G0008200
rosa_samantha	Rh1BG396000 Rh1CG409000 Rh2CG325300 Rh4AG142900 Rh4AG276000 Rh5CG272500 Rh5CG276700 Rh6BG126600 Rh6DG111600
rosa_wichuraiana	Rw2G011210 Rw3G012340 Rw3G019470 Rw4G034300 Rw5G010750 Rw5G022370 Rw5G022390 Rw5G022420 Rw6G007260 Rw7G036970

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	241
AccI	GTMKAC	1 cut(s)	145
AciI	CCGC	2 cut(s)	5, 23
AcsI	RAATTY	1 cut(s)	45
AcuI	CTGAAG	1 cut(s)	144
AcyI	GRCGYC	1 cut(s)	38
AgsI	TTSAA	1 cut(s)	52
AluBI	AGCT	5 cut(s)	28, 60, 128, 199, 229
AluI	AGCT	5 cut(s)	28, 60, 128, 199, 229
AlwNI	CAGNNNCTG	1 cut(s)	202
ApeKI	GCWGC	2 cut(s)	28, 205
ApoI	RAATTY	1 cut(s)	45
BauI	CACGAG	1 cut(s)	84
BbvI	GCAGC	2 cut(s)	15, 217
BccI	CCATC	2 cut(s)	4, 106
BceAI	ACGGC	1 cut(s)	36
BfaI	CTAG	1 cut(s)	295
BfmI	CTRYAG	1 cut(s)	203
BfuAI	ACCTGC	1 cut(s)	241
BisI	GCNGC	2 cut(s)	29, 206
BlsI	GCNGC	2 cut(s)	30, 207
BmsI	GCATC	1 cut(s)	170
BpmI	CTGGAG	1 cut(s)	53
BsaBI	GATNNNNATC	1 cut(s)	172
BsaHI	GRCGYC	1 cut(s)	38
Bse3DI	GCAATG	1 cut(s)	117
Bse8I	GATNNNNATC	1 cut(s)	172
BseGI	GGATG	4 cut(s)	15, 19, 117, 161
BseJI	GATNNNNATC	1 cut(s)	172
BseMI	GCAATG	1 cut(s)	117
BseXI	GCAGC	2 cut(s)	15, 217
Bsp143I	GATC	1 cut(s)	167
BspACI	CCGC	2 cut(s)	5, 23
BspMAI	CTGCAG	1 cut(s)	207
BspMI	ACCTGC	1 cut(s)	241
BsrDI	GCAATG	1 cut(s)	117
BssMI	GATC	1 cut(s)	167
BssNI	GRCGYC	1 cut(s)	38
BssSI	CACGAG	1 cut(s)	84
Bst2BI	CACGAG	1 cut(s)	84
BstACI	GRCGYC	1 cut(s)	38
BstC8I	GCNNGC	1 cut(s)	248
BstDEI	CTNAG	1 cut(s)	61
BstF5I	GGATG	4 cut(s)	15, 19, 117, 161
BstKTI	GATC	1 cut(s)	170
BstMBI	GATC	1 cut(s)	167
BstMWI	GCNNNNNNNGC	1 cut(s)	205
BstSFI	CTRYAG	1 cut(s)	203
BstV1I	GCAGC	2 cut(s)	15, 217
BtsCI	GGATG	4 cut(s)	15, 19, 117, 161
BveI	ACCTGC	1 cut(s)	241
Cac8I	GCNNGC	1 cut(s)	248
CaiI	CAGNNNCTG	1 cut(s)	202
CseI	GACGC	1 cut(s)	27
CviJI	RGCY	6 cut(s)	28, 60, 96, 128, 199, 229
CviKI_1	RGCY	6 cut(s)	28, 60, 96, 128, 199, 229
DdeI	CTNAG	1 cut(s)	61
DpnI	GATC	1 cut(s)	169
DpnII	GATC	1 cut(s)	167
EciI	GGCGGA	1 cut(s)	38
Eco57I	CTGAAG	1 cut(s)	144
FaiI	YATR	1 cut(s)	291
FalI	AAGNNNNNCTT	2 cut(s)	44, 76
FblI	GTMKAC	1 cut(s)	145
Fnu4HI	GCNGC	2 cut(s)	29, 206
FokI	GGATG	4 cut(s)	22, 26, 124, 148
Fsp4HI	GCNGC	2 cut(s)	29, 206
FspBI	CTAG	1 cut(s)	295
GluI	GCNGC	2 cut(s)	29, 206
GsuI	CTGGAG	1 cut(s)	53
HgaI	GACGC	1 cut(s)	27
Hin1I	GRCGYC	1 cut(s)	38
Hpy166II	GTNNAC	1 cut(s)	146
Hpy188III	TCNNGA	2 cut(s)	165, 281
Hpy8I	GTNNAC	1 cut(s)	146
Hpy99I	CGWCG	1 cut(s)	43
HpyAV	CCTTC	2 cut(s)	61, 276
HpyCH4V	TGCA	2 cut(s)	205, 246
HpyF10VI	GCNNNNNNNGC	1 cut(s)	205
HpyF3I	CTNAG	1 cut(s)	61
Hsp92I	GRCGYC	1 cut(s)	38
Kzo9I	GATC	1 cut(s)	167
LmnI	GCTCC	1 cut(s)	25
LpnPI	CCDG	5 cut(s)	17, 121, 234, 236, 239
Lsp1109I	GCAGC	2 cut(s)	15, 217
LweI	GCATC	1 cut(s)	170
MaeI	CTAG	1 cut(s)	295
MalI	GATC	1 cut(s)	169
MboI	GATC	1 cut(s)	167
MboII	GAAGA	1 cut(s)	64
MfeI	CAATTG	1 cut(s)	106
MluCI	AATT	2 cut(s)	45, 106
MnlI	CCTC	2 cut(s)	28, 113
MseI	TTAA	1 cut(s)	192
MunI	CAATTG	1 cut(s)	106
MwoI	GCNNNNNNNGC	1 cut(s)	205
NdeII	GATC	1 cut(s)	167
PkrI	GCNGC	2 cut(s)	30, 207
PstI	CTGCAG	1 cut(s)	207
PstNI	CAGNNNCTG	1 cut(s)	202
SaqAI	TTAA	1 cut(s)	192
SatI	GCNGC	2 cut(s)	29, 206
Sau3AI	GATC	1 cut(s)	167
SetI	ASST	7 cut(s)	30, 62, 105, 130, 201, 231, 255
SfaNI	GCATC	1 cut(s)	170
SfcI	CTRYAG	1 cut(s)	203
Sse9I	AATT	2 cut(s)	45, 106
SsiI	CCGC	2 cut(s)	5, 23
SspMI	CTAG	1 cut(s)	295
TaqI	TCGA	1 cut(s)	41
TasI	AATT	2 cut(s)	45, 106
Tru1I	TTAA	1 cut(s)	192
Tru9I	TTAA	1 cut(s)	192
TseI	GCWGC	2 cut(s)	28, 205
XapI	RAATTY	1 cut(s)	45
XmiI	GTMKAC	1 cut(s)	145
XspI	CTAG	1 cut(s)	295

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.