RLG00000034457

No description available

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr7
Physical Location & Seq
Forward (+)
43007185 .. 43007707
523 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000034457

Sequence Viewer

Length: 375 bp
ATGGCCACTGCTAGCCTTATGGCTAAATGGATCTTACTTCTCGTCGTGCGCTTTCGTTCAACTGACGGTGGTTATGGTGATGGCAGCGGCAATCTTGAAATGGTGAAGAACGATGTGGTTAGGTTTAGAGGAGAACAAATTGGTGTTGGGGTGATTACCTCAACTGTATTGTTATGTTTAGACCTATGTTCGTTGGGGAGGCTAACAGTTGGGAAGGGCTGCTTTAATCGGATCTGTGTTGGTGTTATGCGGCAGCGACGTATGGGGGAGGAGGTGGTGATCTGGAATTTGGTAGTAGTAGACTGGCGAACAAGGATGGTCGCGATGATTCTATTGTCGTTGGGTGAGGTGGTTTGCGATGTCGATGTCCTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

125

Amino Acids

13.67

Weight (kDa)

8.37

Isoelectric Point (pI)

22.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 300
AccII CGCG 1 cut(s) 323
AciI CCGC 2 cut(s) 87, 250
AclWI GGATC 2 cut(s) 38, 239
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 1 cut(s) 286
AgsI TTSAA 2 cut(s) 60, 98
AlwI GGATC 2 cut(s) 38, 239
AoxI GGCC 1 cut(s) 3
ApeKI GCWGC 3 cut(s) 84, 219, 253
ApoI RAATTY 1 cut(s) 286
AspLEI GCGC 1 cut(s) 51
AsuHPI GGTGA 5 cut(s) 89, 115, 163, 289, 356
AsuNHI GCTAGC 1 cut(s) 11
BalI TGGCCA 1 cut(s) 5
BbvI GCAGC 3 cut(s) 96, 206, 265
BccI CCATC 2 cut(s) 74, 310
BfaI CTAG 2 cut(s) 12, 373
BisI GCNGC 5 cut(s) 85, 88, 220, 251, 254
BlsI GCNGC 5 cut(s) 86, 89, 221, 252, 255
BmtI GCTAGC 1 cut(s) 15
Bse1I ACTGG 1 cut(s) 308
BseGI GGATG 1 cut(s) 321
BseNI ACTGG 1 cut(s) 308
BseRI GAGGAG 2 cut(s) 144, 284
BseXI GCAGC 3 cut(s) 96, 206, 265
Bsh1236I CGCG 1 cut(s) 323
BshFI GGCC 1 cut(s) 5
BsnI GGCC 1 cut(s) 5
Bsp143I GATC 3 cut(s) 30, 231, 279
Bsp68I TCGCGA 1 cut(s) 323
BspACI CCGC 2 cut(s) 87, 250
BspANI GGCC 1 cut(s) 5
BspFNI CGCG 1 cut(s) 323
BspOI GCTAGC 1 cut(s) 15
BspPI GGATC 2 cut(s) 38, 239
BsrI ACTGG 1 cut(s) 308
BssMI GATC 3 cut(s) 30, 231, 279
Bst4CI ACNGT 3 cut(s) 68, 166, 208
BstC8I GCNNGC 1 cut(s) 13
BstF5I GGATG 1 cut(s) 321
BstFNI CGCG 1 cut(s) 323
BstHHI GCGC 1 cut(s) 51
BstKTI GATC 3 cut(s) 33, 234, 282
BstMBI GATC 3 cut(s) 30, 231, 279
BstUI CGCG 1 cut(s) 323
BstV1I GCAGC 3 cut(s) 96, 206, 265
BstX2I RGATCY 2 cut(s) 30, 231
BstYI RGATCY 2 cut(s) 30, 231
BsuRI GGCC 1 cut(s) 5
BtgZI GCGATG 1 cut(s) 338
BtsCI GGATG 1 cut(s) 321
BtsI GCAGTG 1 cut(s) 6
BtsIMutI CAGTG 1 cut(s) 6
BtuMI TCGCGA 1 cut(s) 323
Cac8I GCNNGC 1 cut(s) 13
CfoI GCGC 1 cut(s) 51
CviJI RGCY 5 cut(s) 5, 15, 23, 202, 219
CviKI_1 RGCY 5 cut(s) 5, 15, 23, 202, 219
DpnI GATC 3 cut(s) 32, 233, 281
DpnII GATC 3 cut(s) 30, 231, 279
EaeI YGGCCR 1 cut(s) 3
FaiI YATR 6 cut(s) 20, 75, 175, 187, 248, 263
FalI AAGNNNNNCTT 2 cut(s) 206, 238
FblI GTMKAC 1 cut(s) 300
Fnu4HI GCNGC 5 cut(s) 85, 88, 220, 251, 254
FokI GGATG 1 cut(s) 328
Fsp4HI GCNGC 5 cut(s) 85, 88, 220, 251, 254
FspBI CTAG 2 cut(s) 12, 373
GlaI GCGC 1 cut(s) 50
GluI GCNGC 5 cut(s) 85, 88, 220, 251, 254
HaeIII GGCC 1 cut(s) 5
HhaI GCGC 1 cut(s) 51
Hin6I GCGC 1 cut(s) 49
HinP1I GCGC 1 cut(s) 49
HinfI GANTC 1 cut(s) 328
HphI GGTGA 5 cut(s) 89, 115, 163, 289, 356
Hpy166II GTNNAC 1 cut(s) 301
Hpy188I TCNGA 1 cut(s) 231
Hpy188III TCNNGA 3 cut(s) 95, 283, 322
Hpy8I GTNNAC 1 cut(s) 301
Hpy99I CGWCG 2 cut(s) 47, 261
HpyAV CCTTC 1 cut(s) 208
HpyCH4III ACNGT 3 cut(s) 68, 166, 208
HpyCH4IV ACGT 1 cut(s) 259
HpySE526I ACGT 1 cut(s) 259
HspAI GCGC 1 cut(s) 49
Kzo9I GATC 3 cut(s) 30, 231, 279
LpnPI CCDG 2 cut(s) 268, 289
Lsp1109I GCAGC 3 cut(s) 96, 206, 265
MaeI CTAG 2 cut(s) 12, 373
MaeII ACGT 1 cut(s) 259
MalI GATC 3 cut(s) 32, 233, 281
MboI GATC 3 cut(s) 30, 231, 279
MboII GAAGA 1 cut(s) 118
MflI RGATCY 2 cut(s) 30, 231
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 2 cut(s) 138, 286
MluNI TGGCCA 1 cut(s) 5
MnlI CCTC 6 cut(s) 122, 169, 192, 262, 265, 340
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
MseI TTAA 1 cut(s) 225
Msp20I TGGCCA 1 cut(s) 5
MspA1I CMGCKG 1 cut(s) 87
MvnI CGCG 1 cut(s) 323
NdeII GATC 3 cut(s) 30, 231, 279
NheI GCTAGC 1 cut(s) 11
NruI TCGCGA 1 cut(s) 323
PfeI GAWTC 1 cut(s) 328
PkrI GCNGC 5 cut(s) 86, 89, 221, 252, 255
PsuI RGATCY 2 cut(s) 30, 231
RruI TCGCGA 1 cut(s) 323
SaqAI TTAA 1 cut(s) 225
SatI GCNGC 5 cut(s) 85, 88, 220, 251, 254
Sau3AI GATC 3 cut(s) 30, 231, 279
SetI ASST 6 cut(s) 125, 161, 186, 262, 276, 351
SgeI CNNG 8 cut(s) 24, 53, 58, 107, 295, 316, 324, 334
Sse9I AATT 2 cut(s) 138, 286
SsiI CCGC 2 cut(s) 87, 250
SspMI CTAG 2 cut(s) 12, 373
TaaI ACNGT 3 cut(s) 68, 166, 208
TaiI ACGT 1 cut(s) 262
TaqI TCGA 1 cut(s) 363
TasI AATT 2 cut(s) 138, 286
TauI GCSGC 2 cut(s) 90, 253
TfiI GAWTC 1 cut(s) 328
Tru1I TTAA 1 cut(s) 225
Tru9I TTAA 1 cut(s) 225
TscAI CASTG 1 cut(s) 13
TseI GCWGC 3 cut(s) 84, 219, 253
TspRI CASTG 1 cut(s) 13
XapI RAATTY 1 cut(s) 286
XmiI GTMKAC 1 cut(s) 300
XspI CTAG 2 cut(s) 12, 373
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.