Rroxscaffold_1G00044280

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
OG0001117
Physical Location & Seq
Reverse (-)
63122665 .. 63123762
1098 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00044280.1

Sequence Viewer

Length: 204 bp
ATGAAAACAACTCCGCCTGAGAATCCAGAGGACTGCAACACCGCTTCTTACCCTCACCGTCGCTATCCCATCACCGCCTGGTCTGGGGACCTTGAGATCACTGTCGCTAGCAATCGAAACCTAGGTTTCGCAATCGAGGTTGCTTCCTCCTCTGATTATTTTGGTTTTTTTATTTTTGAAAAACTAATTCTATTTATCATGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

67

Amino Acids

7.62

Weight (kDa)

4.79

Isoelectric Point (pI)

48.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 14, 42, 75
AfiI CCNNNNNNNGG 1 cut(s) 84
AgsI TTSAA 1 cut(s) 179
AjnI CCWGG 1 cut(s) 77
AspA2I CCTAGG 1 cut(s) 121
AspS9I GGNCC 1 cut(s) 88
AsuHPI GGTGA 2 cut(s) 47, 64
AsuNHI GCTAGC 1 cut(s) 107
AvaII GGWCC 1 cut(s) 88
AvrII CCTAGG 1 cut(s) 121
BccI CCATC 1 cut(s) 77
BciT130I CCWGG 1 cut(s) 79
BfaI CTAG 2 cut(s) 108, 122
BlnI CCTAGG 1 cut(s) 121
Bme1390I CCNGG 1 cut(s) 79
Bme18I GGWCC 1 cut(s) 88
BmgT120I GGNCC 1 cut(s) 88
BmiI GGNNCC 1 cut(s) 89
BmrFI CCNGG 1 cut(s) 79
BmtI GCTAGC 1 cut(s) 111
BpuEI CTTGAG 1 cut(s) 113
BsaJI CCNNGG 1 cut(s) 121
Bsc4I CCNNNNNNNGG 1 cut(s) 84
BseBI CCWGG 1 cut(s) 79
BseDI CCNNGG 1 cut(s) 121
BseLI CCNNNNNNNGG 1 cut(s) 84
BseMII CTCAG 1 cut(s) 9
BseRI GAGGAG 1 cut(s) 139
BslFI GGGAC 1 cut(s) 101
BslI CCNNNNNNNGG 1 cut(s) 84
BsmFI GGGAC 1 cut(s) 101
Bsp143I GATC 1 cut(s) 96
BspACI CCGC 3 cut(s) 14, 42, 75
BspCNI CTCAG 1 cut(s) 10
BspLI GGNNCC 1 cut(s) 89
BspOI GCTAGC 1 cut(s) 111
BssECI CCNNGG 1 cut(s) 121
BssMI GATC 1 cut(s) 96
BssT1I CCWWGG 1 cut(s) 121
Bst2UI CCWGG 1 cut(s) 79
Bst4CI ACNGT 2 cut(s) 59, 103
BstC8I GCNNGC 1 cut(s) 109
BstDEI CTNAG 1 cut(s) 18
BstKTI GATC 1 cut(s) 99
BstMBI GATC 1 cut(s) 96
BstNI CCWGG 1 cut(s) 79
BstSCI CCNGG 1 cut(s) 77
BtsIMutI CAGTG 1 cut(s) 99
Cac8I GCNNGC 1 cut(s) 109
Cfr13I GGNCC 1 cut(s) 88
CviAII CATG 1 cut(s) 199
DdeI CTNAG 1 cut(s) 18
DpnI GATC 1 cut(s) 98
DpnII GATC 1 cut(s) 96
Eco130I CCWWGG 1 cut(s) 121
Eco47I GGWCC 1 cut(s) 88
EcoO109I RGGNCCY 1 cut(s) 88
EcoRII CCWGG 1 cut(s) 77
EcoT14I CCWWGG 1 cut(s) 121
ErhI CCWWGG 1 cut(s) 121
FaeI CATG 1 cut(s) 202
FaiI YATR 1 cut(s) 200
FaqI GGGAC 1 cut(s) 101
FatI CATG 1 cut(s) 198
FspBI CTAG 2 cut(s) 108, 122
Hin1II CATG 1 cut(s) 202
HinfI GANTC 1 cut(s) 22
HphI GGTGA 2 cut(s) 47, 64
Hpy188I TCNGA 1 cut(s) 154
Hpy188III TCNNGA 1 cut(s) 26
Hpy99I CGWCG 1 cut(s) 63
HpyCH4III ACNGT 2 cut(s) 59, 103
HpyCH4V TGCA 1 cut(s) 36
HpyF3I CTNAG 1 cut(s) 18
Hsp92II CATG 1 cut(s) 202
Kzo9I GATC 1 cut(s) 96
LpnPI CCDG 5 cut(s) 30, 39, 64, 69, 91
MaeI CTAG 2 cut(s) 108, 122
MalI GATC 1 cut(s) 98
MboI GATC 1 cut(s) 96
MluCI AATT 1 cut(s) 186
MnlI CCTC 5 cut(s) 22, 63, 130, 157, 160
MspR9I CCNGG 1 cut(s) 79
MvaI CCWGG 1 cut(s) 79
NdeII GATC 1 cut(s) 96
NheI GCTAGC 1 cut(s) 107
NlaIII CATG 1 cut(s) 202
NlaIV GGNNCC 1 cut(s) 89
PfeI GAWTC 1 cut(s) 22
PpuMI RGGWCCY 1 cut(s) 88
Psp5II RGGWCCY 1 cut(s) 88
Psp6I CCWGG 1 cut(s) 77
PspGI CCWGG 1 cut(s) 77
PspN4I GGNNCC 1 cut(s) 89
PspPI GGNCC 1 cut(s) 88
PspPPI RGGWCCY 1 cut(s) 88
Sau3AI GATC 1 cut(s) 96
Sau96I GGNCC 1 cut(s) 88
ScrFI CCNGG 1 cut(s) 79
SetI ASST 4 cut(s) 93, 123, 127, 141
SgeI CNNG 9 cut(s) 29, 38, 90, 91, 96, 104, 120, 134, 148
SinI GGWCC 1 cut(s) 88
SmlI CTYRAG 1 cut(s) 92
SmoI CTYRAG 1 cut(s) 92
Sse9I AATT 1 cut(s) 186
SsiI CCGC 3 cut(s) 14, 42, 75
SspMI CTAG 2 cut(s) 108, 122
StyD4I CCNGG 1 cut(s) 77
StyI CCWWGG 1 cut(s) 121
TaaI ACNGT 2 cut(s) 59, 103
TaqI TCGA 2 cut(s) 115, 135
TasI AATT 1 cut(s) 186
TfiI GAWTC 1 cut(s) 22
TscAI CASTG 1 cut(s) 106
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 106
VpaK11BI GGWCC 1 cut(s) 88
XmaJI CCTAGG 1 cut(s) 121
XspI CTAG 2 cut(s) 108, 122
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.