Rroxscaffold_1G00046100

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
65224469 .. 65225374
906 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00046100.1

Sequence Viewer

Length: 156 bp
ATGGTGATGTGGATGTCGTGGGCTCGGCTAGCATTGGAAGGGGAGCCTGCTACTTCTCTTCCGACAACTATTAAATTTTGTTGGGTCGCAAATATCATAATCTCTGAAGGTTTTTTTTATCTTGTTTCGGAGATTTCTGATTTTTGTTTGGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

51

Amino Acids

5.85

Weight (kDa)

4.31

Isoelectric Point (pI)

59.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 74
AcuI CTGAAG 1 cut(s) 126
ApoI RAATTY 1 cut(s) 74
AsuHPI GGTGA 1 cut(s) 16
AsuNHI GCTAGC 1 cut(s) 28
BanII GRGCYC 1 cut(s) 25
BfaI CTAG 1 cut(s) 29
BmiI GGNNCC 1 cut(s) 45
BmtI GCTAGC 1 cut(s) 32
BseGI GGATG 1 cut(s) 18
Bsp1286I GDGCHC 1 cut(s) 25
BspLI GGNNCC 1 cut(s) 45
BspOI GCTAGC 1 cut(s) 32
Bst6I CTCTTC 1 cut(s) 63
BstC8I GCNNGC 2 cut(s) 30, 48
BstF5I GGATG 1 cut(s) 18
BstMWI GCNNNNNNNGC 1 cut(s) 29
BtsCI GGATG 1 cut(s) 18
Cac8I GCNNGC 2 cut(s) 30, 48
CviJI RGCY 3 cut(s) 23, 28, 46
CviKI_1 RGCY 3 cut(s) 23, 28, 46
Eam1104I CTCTTC 1 cut(s) 63
EarI CTCTTC 1 cut(s) 63
Eco24I GRGCYC 1 cut(s) 25
Eco57I CTGAAG 1 cut(s) 126
EcoT38I GRGCYC 1 cut(s) 25
FaiI YATR 1 cut(s) 98
FokI GGATG 1 cut(s) 25
FriOI GRGCYC 1 cut(s) 25
FspBI CTAG 1 cut(s) 29
HphI GGTGA 1 cut(s) 16
Hpy188I TCNGA 4 cut(s) 63, 106, 130, 139
HpyAV CCTTC 2 cut(s) 32, 101
HpyF10VI GCNNNNNNNGC 1 cut(s) 29
LmnI GCTCC 1 cut(s) 43
LpnPI CCDG 1 cut(s) 60
MaeI CTAG 1 cut(s) 29
MboII GAAGA 1 cut(s) 50
MhlI GDGCHC 1 cut(s) 25
MluCI AATT 1 cut(s) 74
MmeI TCCRAC 1 cut(s) 86
MseI TTAA 1 cut(s) 72
MwoI GCNNNNNNNGC 1 cut(s) 29
NheI GCTAGC 1 cut(s) 28
NlaIV GGNNCC 1 cut(s) 45
NmeAIII GCCGAG 1 cut(s) 4
PspN4I GGNNCC 1 cut(s) 45
SaqAI TTAA 1 cut(s) 72
SduI GDGCHC 1 cut(s) 25
SetI ASST 1 cut(s) 112
SgeI CNNG 5 cut(s) 30, 36, 41, 59, 134
Sse9I AATT 1 cut(s) 74
SspMI CTAG 1 cut(s) 29
TasI AATT 1 cut(s) 74
Tru1I TTAA 1 cut(s) 72
Tru9I TTAA 1 cut(s) 72
XapI RAATTY 1 cut(s) 74
XspI CTAG 1 cut(s) 29
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.