Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8282945.1

Orthogroup ID

OG0000718

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 535

Gene Structure 535 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8282945.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 204 bp

atggaaaagagtaatttcaagattgcaactgatgaagaaattgagattgcacattcggggcagtatcttctaaatcttcccatcgtggttgatgaatctaagattgacaagaagcttctgaagaacttctttgcagagaatcctcagcaaaaccttccagattttgctgataagtacattatcttccggcgtggtgttggactt

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF3754

Protein Analysis

68

Amino Acids

7.85

Weight (kDa)

5.24

Isoelectric Point (pI)

23.03

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000718)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G19340
fragaria_vesca	FvH4_6g50540 FvH4_6g50540 FvH4_6g50540 FvH4_6g50540 FvH4_6g54351 FvH4_6g54352
malus_domestica	MD09G1002100.v1.1 MD09G1035500.v1.1 MD17G1006300.v1.1
prunus_persica	Prupe.3G282800_v2.0.a1 Prupe.3G314100_v2.0.a1 Prupe.3G314100_v2.0.a1 Prupe.3G314100_v2.0.a1
pyrus_communis	pycom111g02830 pycom17g00180
rosa_chinensis	RchiOBHm_Chr2g0171021 RchiOBHm_Chr2g0171051 RchiOBHm_Chr2g0176571 RchiOBHm_Chr2g0176581 RchiOBHm_Chr2g0176591 RchiOBHm_Chr4g0402101
rosa_laevigata	RLG00000019532 RLG00000021999 RLG00000022426 RLG00000022427 RLG00000030813 RLG00000034042
rosa_multiflora	Rmu_co8282945.1_g000001 Rmu_sc0001417.1_g000012 Rmu_sc0001782.1_g000018 Rmu_sc0003517.1_g000001 Rmu_sc0007623.1_g000005 Rmu_sc0035601.1_g000001
rosa_roxburghii	Rroxscaffold_1G00025090 Rroxscaffold_2G00076280 Rroxscaffold_2G00076290 Rroxscaffold_2G00080870 Rroxscaffold_2G00080890 Rroxscaffold_2G00133310 Rroxscaffold_5G00340280
rosa_rugosa	Rorug02G0552900 Rorug02G0553300 Rorug02G0596200 Rorug05G0287200
rosa_samantha	Rh2AG625400 Rh2AG626600 Rh2AG626800 Rh2AG674200 Rh2AG674300 Rh2BG636700 Rh2BG685400 Rh2CG604900 Rh2CG605700 Rh2CG648400 Rh2CG648500 Rh2CG648600 Rh2DG390600 Rh2DG648400 Rh2DG699300 Rh2DG699400 Rh2DG699500 Rh3AG109000 Rh4DG067200 Rh5AG358400 Rh6CG152900 Rh6CG159900 Rh7AG305100
rosa_wichuraiana	Rw2G029960 Rw2G051860 Rw2G051880 Rw2G055300 Rw2G055310

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcuI	CTGAAG	1 cut(s)	140
AfaI	GTAC	1 cut(s)	176
AgsI	TTSAA	1 cut(s)	19
AluBI	AGCT	1 cut(s)	115
AluI	AGCT	1 cut(s)	115
Asp700I	GAANNNNTTC	1 cut(s)	125
BarI	GAAGNNNNNNTAC	2 cut(s)	167, 199
BbvCI	CCTCAGC	1 cut(s)	144
BccI	CCATC	1 cut(s)	89
Bpu10I	CCTNAGC	1 cut(s)	144
BseMII	CTCAG	1 cut(s)	158
BsiSI	CCGG	1 cut(s)	187
BspCNI	CTCAG	1 cut(s)	157
BstDEI	CTNAG	2 cut(s)	99, 144
Csp6I	GTAC	1 cut(s)	175
CviJI	RGCY	1 cut(s)	115
CviKI_1	RGCY	1 cut(s)	115
CviQI	GTAC	1 cut(s)	175
DdeI	CTNAG	2 cut(s)	99, 144
Eco57I	CTGAAG	1 cut(s)	140
FalI	AAGNNNNNCTT	2 cut(s)	113, 145
HapII	CCGG	1 cut(s)	187
HindIII	AAGCTT	1 cut(s)	113
HinfI	GANTC	2 cut(s)	95, 139
HpaII	CCGG	1 cut(s)	187
Hpy188I	TCNGA	1 cut(s)	120
Hpy188III	TCNNGA	2 cut(s)	19, 158
HpyAV	CCTTC	1 cut(s)	164
HpyCH4V	TGCA	3 cut(s)	26, 50, 134
HpyF3I	CTNAG	2 cut(s)	99, 144
LpnPI	CCDG	2 cut(s)	171, 200
MboII	GAAGA	5 cut(s)	47, 59, 68, 133, 175
MluCI	AATT	2 cut(s)	13, 39
MmeI	TCCRAC	1 cut(s)	178
MnlI	CCTC	1 cut(s)	153
MroXI	GAANNNNTTC	1 cut(s)	125
MspI	CCGG	1 cut(s)	187
PdmI	GAANNNNTTC	1 cut(s)	125
PfeI	GAWTC	2 cut(s)	95, 139
RsaI	GTAC	1 cut(s)	176
RsaNI	GTAC	1 cut(s)	175
SetI	ASST	2 cut(s)	117, 156
SgeI	CNNG	6 cut(s)	31, 69, 97, 121, 170, 199
Sse9I	AATT	2 cut(s)	13, 39
TasI	AATT	2 cut(s)	13, 39
TatI	WGTACW	1 cut(s)	174
TfiI	GAWTC	2 cut(s)	95, 139
TspDTI	ATGAA	2 cut(s)	48, 108
XmnI	GAANNNNTTC	1 cut(s)	125

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.