Rroxscaffold_1G00025090

Protein of unknown function (DUF3754)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
OG0000718
Physical Location & Seq
Forward (+)
31431307 .. 31433623
2317 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00025090.1

Sequence Viewer

Length: 237 bp
ATGTCCTTGGCCAACCTCATTGAACATAGTTCTAACCGGGCAGTGTTTTTAAAGCTCTACAAGAGAATTAAGTACACGATTCAAGCTTGGTATCTTCTACAATTCGAGGATTTGATGGTGATGGAAAAGAGTAATTTCAAGATTGCAACTGATGAAGAAATTGAGATTGCGCATTTGGGGCAGTATTTTCTAAATTTTCCCATTGTTGTTGATGAATCTAAGTTTGATGGCAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF3754

Protein Analysis

78

Amino Acids

9.22

Weight (kDa)

5.21

Isoelectric Point (pI)

36.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 171
AcoI YGGCCR 1 cut(s) 9
AcsI RAATTY 1 cut(s) 193
AfaI GTAC 1 cut(s) 74
AgsI TTSAA 3 cut(s) 23, 83, 139
AluBI AGCT 2 cut(s) 55, 86
AluI AGCT 2 cut(s) 55, 86
AoxI GGCC 1 cut(s) 9
ApoI RAATTY 1 cut(s) 193
AspLEI GCGC 1 cut(s) 172
AsuC2I CCSGG 1 cut(s) 38
AsuHPI GGTGA 1 cut(s) 130
BalI TGGCCA 1 cut(s) 11
BccI CCATC 3 cut(s) 109, 115, 221
BcnI CCSGG 1 cut(s) 38
Bme1390I CCNGG 1 cut(s) 38
BmrFI CCNGG 1 cut(s) 38
BpuMI CCSGG 1 cut(s) 38
BsaJI CCNNGG 1 cut(s) 6
BseDI CCNNGG 1 cut(s) 6
BshFI GGCC 1 cut(s) 11
BsiSI CCGG 1 cut(s) 37
BsnI GGCC 1 cut(s) 11
BspANI GGCC 1 cut(s) 11
BssECI CCNNGG 1 cut(s) 6
BssT1I CCWWGG 1 cut(s) 6
BstDEI CTNAG 1 cut(s) 219
BstHHI GCGC 1 cut(s) 172
BstMWI GCNNNNNNNGC 1 cut(s) 178
BstSCI CCNGG 1 cut(s) 36
BsuRI GGCC 1 cut(s) 11
BtsI GCAGTG 1 cut(s) 48
BtsIMutI CAGTG 1 cut(s) 48
CfoI GCGC 1 cut(s) 172
Csp6I GTAC 1 cut(s) 73
CviJI RGCY 3 cut(s) 11, 55, 86
CviKI_1 RGCY 3 cut(s) 11, 55, 86
CviQI GTAC 1 cut(s) 73
DdeI CTNAG 1 cut(s) 219
DraI TTTAAA 1 cut(s) 51
EaeI YGGCCR 1 cut(s) 9
Eco130I CCWWGG 1 cut(s) 6
EcoT14I CCWWGG 1 cut(s) 6
ErhI CCWWGG 1 cut(s) 6
FaiI YATR 1 cut(s) 27
FspI TGCGCA 1 cut(s) 171
GlaI GCGC 1 cut(s) 171
HaeIII GGCC 1 cut(s) 11
HapII CCGG 1 cut(s) 37
HhaI GCGC 1 cut(s) 172
Hin6I GCGC 1 cut(s) 170
HinP1I GCGC 1 cut(s) 170
HindIII AAGCTT 1 cut(s) 84
HinfI GANTC 2 cut(s) 79, 215
HpaII CCGG 1 cut(s) 37
HphI GGTGA 1 cut(s) 130
Hpy166II GTNNAC 1 cut(s) 75
Hpy188III TCNNGA 1 cut(s) 139
Hpy8I GTNNAC 1 cut(s) 75
HpyCH4V TGCA 1 cut(s) 146
HpyF10VI GCNNNNNNNGC 1 cut(s) 178
HpyF3I CTNAG 1 cut(s) 219
HspAI GCGC 1 cut(s) 170
LpnPI CCDG 1 cut(s) 50
MboII GAAGA 2 cut(s) 86, 167
MlsI TGGCCA 1 cut(s) 11
MluCI AATT 5 cut(s) 66, 101, 133, 159, 193
MluNI TGGCCA 1 cut(s) 11
MnlI CCTC 2 cut(s) 26, 100
Mox20I TGGCCA 1 cut(s) 11
MscI TGGCCA 1 cut(s) 11
MseI TTAA 2 cut(s) 50, 69
Msp20I TGGCCA 1 cut(s) 11
MspI CCGG 1 cut(s) 37
MspR9I CCNGG 1 cut(s) 38
MwoI GCNNNNNNNGC 1 cut(s) 178
NciI CCSGG 1 cut(s) 38
NsbI TGCGCA 1 cut(s) 171
PfeI GAWTC 2 cut(s) 79, 215
RsaI GTAC 1 cut(s) 74
RsaNI GTAC 1 cut(s) 73
SaqAI TTAA 2 cut(s) 50, 69
ScrFI CCNGG 1 cut(s) 38
SetI ASST 3 cut(s) 18, 57, 88
SgeI CNNG 9 cut(s) 19, 49, 50, 73, 88, 95, 99, 118, 151
Sse9I AATT 5 cut(s) 66, 101, 133, 159, 193
StyD4I CCNGG 1 cut(s) 36
StyI CCWWGG 1 cut(s) 6
TaqI TCGA 1 cut(s) 105
TasI AATT 5 cut(s) 66, 101, 133, 159, 193
TatI WGTACW 1 cut(s) 72
TfiI GAWTC 2 cut(s) 79, 215
Tru1I TTAA 2 cut(s) 50, 69
Tru9I TTAA 2 cut(s) 50, 69
TscAI CASTG 1 cut(s) 48
TspDTI ATGAA 2 cut(s) 168, 228
TspRI CASTG 1 cut(s) 48
XapI RAATTY 1 cut(s) 193
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.