Rmu_sc0024683.1_g000001

Arm repeat protein interacting with

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0024683.1
Physical Location & Seq
Forward (+)
1 .. 5668
5668 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0024683.1_g000001.1.cds

Sequence Viewer

Length: 1761 bp
cccgagcatcaacaactcattgttgataatggtgcattgtctcatctagtagatttgttgaagaggcacaaggatagtcatgtaactcgacctttgtatagcgtcattcgtagagctgctgatgccatcaccaatctcgctcatgaaaacagcagcattaaaacccgtgtcaggatagaaggtggaattccacctctagttgagttgcttgaatttgccgatacaaaggtgcaaagagcagctgctggagcgctacgaaccctcgcatttaaaaatgatgagaataagaatcagattgttgaatgcaatgctcttcctaccctcattttaatgcttcgatctgaagatgctgctatacattacgaagcggttggtgtaattggaaatctagttcactcttctccaaacataaagaaagaggttcttcttgcgggagctttacaacctgttattggattgcttagttcctgctgctttgagagccaaagagaggcagctttgctacttggacaatttgctgcaactgattcagactgcaaggttcacattgtacagaggggtgctgtccgacctttgattgagatgcttcaatccccagatgtacaactcagggagatgtcagcttttgctttggggaggttggcacaggactcacacaaccaagctggtattgctcataatggtggtttattgccattgttgaaacttctggattcaaaaaatgggtctctgcaacacaatgctgcatttaccctttacggccttgcagataatgaggataatgtgtccgattttattagggttggtggtgttcagaagttgcaggatggagaatttattttccaagctacaaaggattgtgtgaccaaaacattgaaaagattagaggagaagattcatgcacgagttttgtcgcatttgttatacttgatgcgtgtagcagagagaaatgtccaaagacgtgttgctttggcttttgctcatctttgctccccagaggatctcagaaccattttcatcgataacaatggtttggaattgcttcttgggcttcttggttctagtagccccaaacagcagcttgatggtgctatggctctgtacaagttggccaacaaagccatgactctttctcctgtggatgcagctcctccatctccaacaccacaggtttatctaggggagcagtatgtaaacaaccctacgctgtccgatgttacgtttttagttgaaggtagacggttctatgctcacagaatttgcctgcttgcttcttcagatgcttttcgtgcaatgtttgatggtggttaccgggagaaggatgcaagggacatcgaaataccaaatattagatgggaggagaaggatgcaagggacatcgaaataccaaatattagatgggaggtttttgagttgatgatgagatttatatacaccggatcagtagacattactttggatattgctcaagatctcctcagagctgcagatcagtatcttttggagggactcaagcggctttgtgagtattcaatagcacaggacatatctttggagaatgtttcaaacatgtatgaactttcagaagccttccatgcaatgtcattaaggcaaacatgtattttgtttatcttggagcagttcgaaaaattgagtgctagaccagggcactgtgaactgatcaagaatatattggatgagatcagatcttactttactaaagcactcactaagcctaacccacataacttgcggctgtag

Protein Analysis

586

Amino Acids

65.48

Weight (kDa)

6.09

Isoelectric Point (pI)

50.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000306)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G19330
fragaria_vesca FvH4_2g23530 FvH4_2g23530 FvH4_2g23530 FvH4_2g23530 FvH4_2g23530 FvH4_2g23530 FvH4_4g15010 FvH4_4g15020 FvH4_4g15040 FvH4_4g15040 FvH4_4g15040 FvH4_4g15040 FvH4_4g15040 FvH4_4g15040
malus_domestica MD03G1264200.v1.1 MD03G1264700.v1.1 MD11G1284800.v1.1 MD13G1187400.v1.1 MD13G1187500.v1.1 MD13G1187900.v1.1 MD13G1188000.v1.1 MD16G1188100.v1.1 MD16G1188500.v1.1 MD16G1188600.v1.1
prunus_persica Prupe.1G154900_v2.0.a1 Prupe.1G155100_v2.0.a1 Prupe.1G155200_v2.0.a1 Prupe.1G155300_v2.0.a1 Prupe.1G155300_v2.0.a1 Prupe.8G240700_v2.0.a1
pyrus_communis pycom03g21190 pycom11g25240 pycom11g25250 pycom13g16210 pycom13g16230 pycom13g16240 pycom16g15820
rosa_chinensis RchiOBHm_Chr1g0343661 RchiOBHm_Chr4g0416821 RchiOBHm_Chr4g0416831 RchiOBHm_Chr4g0416841 RchiOBHm_Chr4g0416871 RchiOBHm_Chr4g0416951 RchiOBHm_Chr4g0416961 RchiOBHm_Chr6g0291001
rosa_laevigata RLG00000007939 RLG00000007940 RLG00000007944 RLG00000007945 RLG00000007946 RLG00000007954 RLG00000012156 RLG00000028955
rosa_multiflora Rmu_co8241865.1_g000001 Rmu_sc0000021.1_g000004 Rmu_sc0000663.1_g000003 Rmu_sc0000663.1_g000009 Rmu_sc0000663.1_g000012 Rmu_sc0000663.1_g000013 Rmu_sc0000663.1_g000021 Rmu_sc0000663.1_g000029 Rmu_sc0014328.1_g000002 Rmu_sc0014328.1_g000003 Rmu_sc0020688.1_g000001 Rmu_sc0024683.1_g000001 Rmu_sc0024683.1_g000002 Rmu_sc0033477.1_g000001 Rmu_sc0035872.1_g000001 Rmu_ssc0000010.1_g000006 Rmu_ssc0000010.1_g000008 Rmu_ssc0000010.1_g000011
rosa_roxburghii Rroxscaffold_4G00310390 Rroxscaffold_5G00360700 Rroxscaffold_5G00360710 Rroxscaffold_5G00360720 Rroxscaffold_5G00360750 Rroxscaffold_5G00360800 Rroxscaffold_5G00360820 Rroxscaffold_7G00176470
rosa_rugosa Rorug04G0145200 Rorug04G0145300 Rorug04G0145400 Rorug04G0145400 Rorug04G0145600.1 Rorug04G0145700.1 Rorug04G0148500 Rorug06G0217000
rosa_samantha Rh2BG232000 Rh4AG207900 Rh4BG205000 Rh4BG205100 Rh4CG218700 Rh4DG134800 Rh4DG204800 Rh4DG204900 Rh4DG205000 Rh4DG205100 Rh4DG205200 Rh4DG205300 Rh4DG205400 Rh4DG205500 Rh5BG434500 Rh5CG457700 Rh6AG326800 Rh6BG334300 Rh6CG340500 Rh6DG327800
rosa_wichuraiana Rw1G015270 Rw4G017570 Rw4G017580 Rw4G017590 Rw4G017600 Rw4G017610 Rw4G017620 Rw4G017630 Rw4G017640 Rw6G028420

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 1237, 1446
AciI CCGC 4 cut(s) 368, 431, 1516, 1753
AclWI GGATC 2 cut(s) 1008, 1447
AcoI YGGCCR 1 cut(s) 1110
AcsI RAATTY 4 cut(s) 186, 212, 833, 1257
AcuI CTGAAG 2 cut(s) 363, 1260
AfaI GTAC 3 cut(s) 552, 603, 1103
AfeI AGCGCT 1 cut(s) 252
AfiI CCNNNNNNNGG 4 cut(s) 171, 452, 490, 1318
AflIII ACRYGT 3 cut(s) 961, 1569, 1616
AjiI CACGTC 1 cut(s) 962
AjnI CCWGG 1 cut(s) 1663
AjuI GAANNNNNNNTTGG 2 cut(s) 1029, 1061
AloI GAACNNNNNNTCC 2 cut(s) 375, 407
Alw26I GTCTC 2 cut(s) 45, 732
AlwI GGATC 2 cut(s) 1008, 1447
AlwNI CAGNNNCTG 1 cut(s) 245
Ama87I CYCGRG 1 cut(s) 2
Aor51HI AGCGCT 1 cut(s) 252
AoxI GGCC 2 cut(s) 760, 1110
ApoI RAATTY 4 cut(s) 186, 212, 833, 1257
ArsI GACNNNNNNTTYG 2 cut(s) 710, 742
Asp700I GAANNNNTTC 1 cut(s) 1041
AspLEI GCGC 1 cut(s) 253
AsuC2I CCSGG 1 cut(s) 1313
AsuHPI GGTGA 1 cut(s) 121
AsuII TTCGAA 1 cut(s) 1644
AvaI CYCGRG 1 cut(s) 2
BaeGI GKGCMC 1 cut(s) 1671
BaeI ACNNNNGTAYC 2 cut(s) 213, 246
BalI TGGCCA 1 cut(s) 1112
BauI CACGAG 1 cut(s) 903
BccI CCATC 7 cut(s) 134, 821, 1079, 1162, 1295, 1347, 1392
BceAI ACGGC 1 cut(s) 775
BciT130I CCWGG 1 cut(s) 1665
BclI TGATCA 1 cut(s) 1680
BcnI CCSGG 1 cut(s) 1313
BcoDI GTCTC 2 cut(s) 45, 732
BfaI CTAG 6 cut(s) 47, 197, 389, 1062, 1178, 1659
BfmI CTRYAG 2 cut(s) 1485, 1757
BfoI RGCGCY 1 cut(s) 254
BglII AGATCT 2 cut(s) 1471, 1706
Bme1390I CCNGG 2 cut(s) 1313, 1665
BmeT110I CYCGRG 1 cut(s) 2
BmgBI CACGTC 1 cut(s) 962
BmrFI CCNGG 2 cut(s) 1313, 1665
BmsI GCATC 9 cut(s) 16, 112, 337, 573, 921, 1132, 1270, 1312, 1357
BpmI CTGGAG 1 cut(s) 267
Bpu14I TTCGAA 1 cut(s) 1644
BpuEI CTTGAG 2 cut(s) 1452, 1496
BpuMI CCSGG 1 cut(s) 1313
Bsa29I ATCGAT 1 cut(s) 1020
BsaBI GATNNNNATC 1 cut(s) 1494
BsaI GGTCTC 1 cut(s) 732
BsaJI CCNNGG 1 cut(s) 1664
BsaWI WCCGGW 1 cut(s) 1436
BsaXI ACNNNNNCTCC 2 cut(s) 1117, 1147
Bsc4I CCNNNNNNNGG 4 cut(s) 171, 452, 490, 1318
Bse3DI GCAATG 3 cut(s) 313, 1299, 1605
Bse8I GATNNNNATC 1 cut(s) 1494
BseBI CCWGG 1 cut(s) 1665
BseCI ATCGAT 1 cut(s) 1020
BseDI CCNNGG 1 cut(s) 1664
BseGI GGATG 5 cut(s) 832, 1147, 1327, 1372, 1702
BseJI GATNNNNATC 1 cut(s) 1494
BseLI CCNNNNNNNGG 4 cut(s) 171, 452, 490, 1318
BseMI GCAATG 3 cut(s) 313, 1299, 1605
BseMII CTCAG 3 cut(s) 622, 1018, 1492
BseRI GAGGAG 4 cut(s) 902, 1140, 1373, 1466
BseSI GKGCMC 1 cut(s) 1671
BshFI GGCC 2 cut(s) 762, 1112
BshVI ATCGAT 1 cut(s) 1020
BsiHKCI CYCGRG 1 cut(s) 2
BsiSI CCGG 2 cut(s) 1312, 1437
BslFI GGGAC 3 cut(s) 1343, 1388, 1521
BslI CCNNNNNNNGG 4 cut(s) 171, 452, 490, 1318
BsmAI GTCTC 2 cut(s) 45, 732
BsmFI GGGAC 3 cut(s) 1343, 1388, 1521
BsmI GAATGC 1 cut(s) 308
BsnI GGCC 2 cut(s) 762, 1112
Bso31I GGTCTC 1 cut(s) 732
BsoBI CYCGRG 1 cut(s) 2
Bsp119I TTCGAA 1 cut(s) 1644
Bsp1286I GDGCHC 1 cut(s) 1671
Bsp1407I TGTACA 3 cut(s) 550, 601, 1101
Bsp143I GATC 8 cut(s) 338, 1000, 1439, 1471, 1489, 1680, 1701, 1706
BspACI CCGC 4 cut(s) 368, 431, 1516, 1753
BspANI GGCC 2 cut(s) 762, 1112
BspCNI CTCAG 3 cut(s) 621, 1017, 1491
BspDI ATCGAT 1 cut(s) 1020
BspHI TCATGA 1 cut(s) 142
BspMAI CTGCAG 1 cut(s) 1489
BspPI GGATC 2 cut(s) 1008, 1447
BspQI GCTCTTC 1 cut(s) 318
BspT104I TTCGAA 1 cut(s) 1644
BspTNI GGTCTC 1 cut(s) 732
BsrDI GCAATG 3 cut(s) 313, 1299, 1605
BsrGI TGTACA 3 cut(s) 550, 601, 1101
BssECI CCNNGG 1 cut(s) 1664
BssMI GATC 8 cut(s) 338, 1000, 1439, 1471, 1489, 1680, 1701, 1706
BssSI CACGAG 1 cut(s) 903
Bst2BI CACGAG 1 cut(s) 903
Bst2UI CCWGG 1 cut(s) 1665
Bst4CI ACNGT 2 cut(s) 1242, 1673
Bst6I CTCTTC 3 cut(s) 56, 318, 403
BstAUI TGTACA 3 cut(s) 550, 601, 1101
BstBI TTCGAA 1 cut(s) 1644
BstC8I GCNNGC 2 cut(s) 1265, 1269
BstDEI CTNAG 5 cut(s) 461, 608, 1004, 1478, 1731
BstEII GGTNACC 1 cut(s) 1307
BstF5I GGATG 5 cut(s) 832, 1147, 1327, 1372, 1702
BstH2I RGCGCY 1 cut(s) 254
BstHHI GCGC 1 cut(s) 253
BstKTI GATC 8 cut(s) 341, 1003, 1442, 1474, 1492, 1683, 1704, 1709
BstMAI GTCTC 2 cut(s) 45, 732
BstMBI GATC 8 cut(s) 338, 1000, 1439, 1471, 1489, 1680, 1701, 1706
BstMWI GCNNNNNNNGC 8 cut(s) 122, 248, 480, 671, 1048, 1118, 1289, 1595
BstNI CCWGG 1 cut(s) 1665
BstNSI RCATGY 2 cut(s) 1573, 1620
BstPI GGTNACC 1 cut(s) 1307
BstSCI CCNGG 2 cut(s) 1311, 1663
BstSFI CTRYAG 2 cut(s) 1485, 1757
BstSLI GKGCMC 1 cut(s) 1671
BstX2I RGATCY 3 cut(s) 1000, 1471, 1706
BstYI RGATCY 3 cut(s) 1000, 1471, 1706
Bsu15I ATCGAT 1 cut(s) 1020
BsuRI GGCC 2 cut(s) 762, 1112
BsuTUI ATCGAT 1 cut(s) 1020
BtrI CACGTC 1 cut(s) 962
BtsCI GGATG 5 cut(s) 832, 1147, 1327, 1372, 1702
BtsIMutI CAGTG 1 cut(s) 1669
Cac8I GCNNGC 2 cut(s) 1265, 1269
CaiI CAGNNNCTG 1 cut(s) 245
CciI TCATGA 1 cut(s) 142
CfoI GCGC 1 cut(s) 253
ClaI ATCGAT 1 cut(s) 1020
CseI GACGC 1 cut(s) 91
Csp6I GTAC 3 cut(s) 551, 602, 1102
CspCI CAANNNNNGTGG 1 cut(s) 1731
CviAII CATG 7 cut(s) 80, 143, 899, 1123, 1570, 1595, 1617
CviQI GTAC 3 cut(s) 551, 602, 1102
DdeI CTNAG 5 cut(s) 461, 608, 1004, 1478, 1731
DpnI GATC 8 cut(s) 340, 1002, 1441, 1473, 1491, 1682, 1703, 1708
DpnII GATC 8 cut(s) 338, 1000, 1439, 1471, 1489, 1680, 1701, 1706
DraI TTTAAA 1 cut(s) 271
EaeI YGGCCR 1 cut(s) 1110
Eam1104I CTCTTC 3 cut(s) 56, 318, 403
EarI CTCTTC 3 cut(s) 56, 318, 403
Eco31I GGTCTC 1 cut(s) 732
Eco47III AGCGCT 1 cut(s) 252
Eco57I CTGAAG 2 cut(s) 363, 1260
Eco88I CYCGRG 1 cut(s) 2
Eco91I GGTNACC 1 cut(s) 1307
EcoO65I GGTNACC 1 cut(s) 1307
EcoRI GAATTC 1 cut(s) 186
EcoRII CCWGG 1 cut(s) 1663
FaeI CATG 7 cut(s) 83, 146, 902, 1126, 1573, 1598, 1620
FalI AAGNNNNNCTT 2 cut(s) 408, 440
FaqI GGGAC 3 cut(s) 1343, 1388, 1521
FatI CATG 7 cut(s) 79, 142, 898, 1122, 1569, 1594, 1616
FauI CCCGC 1 cut(s) 424
FbaI TGATCA 1 cut(s) 1680
FblI GTMKAC 2 cut(s) 1237, 1446
FokI GGATG 5 cut(s) 839, 1154, 1334, 1379, 1709
FspBI CTAG 6 cut(s) 47, 197, 389, 1062, 1178, 1659
GlaI GCGC 1 cut(s) 252
GsuI CTGGAG 1 cut(s) 267
HaeII RGCGCY 1 cut(s) 254
HaeIII GGCC 2 cut(s) 762, 1112
HapII CCGG 2 cut(s) 1312, 1437
HgaI GACGC 1 cut(s) 91
HhaI GCGC 1 cut(s) 253
Hin1II CATG 7 cut(s) 83, 146, 902, 1126, 1573, 1598, 1620
Hin6I GCGC 1 cut(s) 251
HinP1I GCGC 1 cut(s) 251
HinfI GANTC 7 cut(s) 289, 527, 650, 713, 895, 1126, 1509
HpaII CCGG 2 cut(s) 1312, 1437
HphI GGTGA 1 cut(s) 121
Hpy166II GTNNAC 6 cut(s) 394, 544, 1195, 1238, 1447, 1676
Hpy188III TCNNGA 5 cut(s) 143, 172, 710, 1469, 1684
Hpy8I GTNNAC 6 cut(s) 394, 544, 1195, 1238, 1447, 1676
HpyAV CCTTC 5 cut(s) 173, 1226, 1312, 1357, 1600
HpyCH4III ACNGT 2 cut(s) 1242, 1673
HpyCH4IV ACGT 2 cut(s) 961, 1220
HpyF10VI GCNNNNNNNGC 8 cut(s) 122, 248, 480, 671, 1048, 1118, 1289, 1595
HpyF3I CTNAG 5 cut(s) 461, 608, 1004, 1478, 1731
HpySE526I ACGT 2 cut(s) 961, 1220
Hsp92II CATG 7 cut(s) 83, 146, 902, 1126, 1573, 1598, 1620
HspAI GCGC 1 cut(s) 251
Ksp22I TGATCA 1 cut(s) 1680
Kzo9I GATC 8 cut(s) 338, 1000, 1439, 1471, 1489, 1680, 1701, 1706
LguI GCTCTTC 1 cut(s) 318
LmnI GCTCC 6 cut(s) 248, 434, 995, 1153, 1183, 1636
LweI GCATC 9 cut(s) 16, 112, 337, 573, 921, 1132, 1270, 1312, 1357
MaeI CTAG 6 cut(s) 47, 197, 389, 1062, 1178, 1659
MaeII ACGT 2 cut(s) 961, 1220
MaeIII GTNAC 4 cut(s) 82, 862, 1216, 1307
MalI GATC 8 cut(s) 340, 1002, 1441, 1473, 1491, 1682, 1703, 1708
MboI GATC 8 cut(s) 338, 1000, 1439, 1471, 1489, 1680, 1701, 1706
MboII GAAGA 7 cut(s) 73, 305, 356, 390, 416, 904, 1266
MflI RGATCY 3 cut(s) 1000, 1471, 1706
MhlI GDGCHC 1 cut(s) 1671
MlsI TGGCCA 1 cut(s) 1112
MluCI AATT 8 cut(s) 186, 212, 378, 512, 833, 1037, 1257, 1649
MluNI TGGCCA 1 cut(s) 1112
MlyI GAGTC 3 cut(s) 644, 1120, 1503
MmeI TCCRAC 2 cut(s) 592, 1184
Mox20I TGGCCA 1 cut(s) 1112
MroXI GAANNNNTTC 1 cut(s) 1041
MscI TGGCCA 1 cut(s) 1112
MseI TTAA 4 cut(s) 159, 270, 329, 1607
MslI CAYNNNNRTG 2 cut(s) 329, 681
Msp20I TGGCCA 1 cut(s) 1112
MspA1I CMGCKG 1 cut(s) 242
MspI CCGG 2 cut(s) 1312, 1437
MspR9I CCNGG 2 cut(s) 1313, 1665
Mva1269I GAATGC 1 cut(s) 308
MvaI CCWGG 1 cut(s) 1665
MwoI GCNNNNNNNGC 8 cut(s) 122, 248, 480, 671, 1048, 1118, 1289, 1595
NciI CCSGG 1 cut(s) 1313
NdeII GATC 8 cut(s) 338, 1000, 1439, 1471, 1489, 1680, 1701, 1706
NlaIII CATG 7 cut(s) 83, 146, 902, 1126, 1573, 1598, 1620
NmuCI GTSAC 1 cut(s) 862
NspI RCATGY 2 cut(s) 1573, 1620
NspV TTCGAA 1 cut(s) 1644
PagI TCATGA 1 cut(s) 142
PciI ACATGT 2 cut(s) 1569, 1616
PciSI GCTCTTC 1 cut(s) 318
PctI GAATGC 1 cut(s) 308
PdmI GAANNNNTTC 1 cut(s) 1041
PfeI GAWTC 4 cut(s) 289, 527, 713, 895
PleI GAGTC 3 cut(s) 644, 1120, 1503
PpsI GAGTC 3 cut(s) 644, 1120, 1503
PscI ACATGT 2 cut(s) 1569, 1616
Psp6I CCWGG 1 cut(s) 1663
PspEI GGTNACC 1 cut(s) 1307
PspGI CCWGG 1 cut(s) 1663
PstI CTGCAG 1 cut(s) 1489
PstNI CAGNNNCTG 1 cut(s) 245
PsuI RGATCY 3 cut(s) 1000, 1471, 1706
PvuII CAGCTG 1 cut(s) 242
RsaI GTAC 3 cut(s) 552, 603, 1103
RsaNI GTAC 3 cut(s) 551, 602, 1102
RseI CAYNNNNRTG 2 cut(s) 329, 681
SapI GCTCTTC 1 cut(s) 318
SaqAI TTAA 4 cut(s) 159, 270, 329, 1607
Sau3AI GATC 8 cut(s) 338, 1000, 1439, 1471, 1489, 1680, 1701, 1706
SchI GAGTC 3 cut(s) 644, 1120, 1503
ScrFI CCNGG 2 cut(s) 1313, 1665
SduI GDGCHC 1 cut(s) 1671
SfaNI GCATC 9 cut(s) 16, 112, 337, 573, 921, 1132, 1270, 1312, 1357
SfcI CTRYAG 2 cut(s) 1485, 1757
SfuI TTCGAA 1 cut(s) 1644
SmiMI CAYNNNNRTG 2 cut(s) 329, 681
SmlI CTYRAG 2 cut(s) 1467, 1511
SmoI CTYRAG 2 cut(s) 1467, 1511
Sse9I AATT 8 cut(s) 186, 212, 378, 512, 833, 1037, 1257, 1649
SsiI CCGC 4 cut(s) 368, 431, 1516, 1753
SspI AATATT 2 cut(s) 1348, 1393
SspMI CTAG 6 cut(s) 47, 197, 389, 1062, 1178, 1659
StyD4I CCNGG 2 cut(s) 1311, 1663
TaaI ACNGT 2 cut(s) 1242, 1673
TaiI ACGT 2 cut(s) 964, 1223
TaqI TCGA 6 cut(s) 88, 337, 1020, 1335, 1380, 1644
TasI AATT 8 cut(s) 186, 212, 378, 512, 833, 1037, 1257, 1649
TatI WGTACW 3 cut(s) 550, 601, 1101
TauI GCSGC 2 cut(s) 1519, 1756
TfiI GAWTC 4 cut(s) 289, 527, 713, 895
Tru1I TTAA 4 cut(s) 159, 270, 329, 1607
Tru9I TTAA 4 cut(s) 159, 270, 329, 1607
TscAI CASTG 1 cut(s) 1676
TseFI GTSAC 1 cut(s) 862
Tsp45I GTSAC 1 cut(s) 862
TspDTI ATGAA 4 cut(s) 159, 887, 1006, 1590
TspRI CASTG 1 cut(s) 1676
XapI RAATTY 4 cut(s) 186, 212, 833, 1257
XceI RCATGY 2 cut(s) 1573, 1620
XcmI CCANNNNNNNNNTGG 2 cut(s) 1350, 1395
XmiI GTMKAC 2 cut(s) 1237, 1446
XmnI GAANNNNTTC 1 cut(s) 1041
XspI CTAG 6 cut(s) 47, 197, 389, 1062, 1178, 1659
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.