Rh7AG282100

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
OG0000495
Physical Location & Seq
Forward (+)
30010395 .. 30019252
8858 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG282100.1

Sequence Viewer

Length: 162 bp
ATGGTTAGTGAAACCATAGCAAGGATTGCCAAGGCACGTTGGGGTGTTGATGTGAGGCCACTCCGACACTTGGATTTGGGTGCTGATCTTGGAAGAAGGACCGAAGCAACTAGATCTTGCGTTCTTGGAATCGAAAGAGGAGGAGAGAAGACTTTTGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

53

Amino Acids

5.88

Weight (kDa)

9.29

Isoelectric Point (pI)

65.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000495)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G12500
fragaria_vesca FvH4_1g10640 FvH4_1g10640 FvH4_1g10640 FvH4_1g10640 FvH4_1g10640 FvH4_1g10641 FvH4_1g10641 FvH4_1g10642 FvH4_1g10643 FvH4_1g10650 FvH4_1g10660 FvH4_1g10660 FvH4_1g10661 FvH4_2g16190
malus_domestica MD02G1120200.v1.1 MD02G1120300.v1.1 MD15G1234400.v1.1
prunus_persica Prupe.7G178500_v2.0.a1 Prupe.8G174900_v2.0.a1
pyrus_communis pycom02g09370 pycom02g09380 pycom02g09390
rosa_chinensis RchiOBHm_Chr2g0097671 RchiOBHm_Chr2g0097691 RchiOBHm_Chr2g0097731 RchiOBHm_Chr2g0097781 RchiOBHm_Chr2g0097801 RchiOBHm_Chr2g0097821 RchiOBHm_Chr6g0279811 RchiOBHm_Chr6g0279831 RchiOBHm_Chr6g0279841
rosa_laevigata RLG00000013112 RLG00000013114 RLG00000016734 RLG00000016736 RLG00000016737 RLG00000016738
rosa_multiflora Rmu_sc0000974.1_g000004 Rmu_sc0000974.1_g000013 Rmu_sc0000974.1_g000019 Rmu_sc0000974.1_g000025 Rmu_sc0002340.1_g000010 Rmu_sc0008442.1_g000003 Rmu_sc0008442.1_g000009 Rmu_sc0020401.1_g000002
rosa_roxburghii Rroxscaffold_2G00140520 Rroxscaffold_2G00144540 Rroxscaffold_2G00144580 Rroxscaffold_2G00144590 Rroxscaffold_7G00188570 Rroxscaffold_7G00188590 Rroxscaffold_7G00188610
rosa_rugosa Rorug02G0068300 Rorug02G0068400 Rorug06G0128600
rosa_samantha Rh2AG114800 Rh2AG114900 Rh2AG115000 Rh2AG115100 Rh2BG117600 Rh2BG117800 Rh2BG117900 Rh2BG118000 Rh2CG119600 Rh2DG118500 Rh2DG118800 Rh2DG119100 Rh2DG119200 Rh2DG119300 Rh5AG369400 Rh5CG403900 Rh6AG236600 Rh6AG236700 Rh6AG236800 Rh6AG237300 Rh6BG241000 Rh6BG241200 Rh6BG241400 Rh6CG243300 Rh6CG243400 Rh6CG243600 Rh6DG234400 Rh6DG234500 Rh7AG282100
rosa_wichuraiana Rw2G008980 Rw2G008990 Rw6G020640

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 2 cut(s) 21, 70
AoxI GGCC 1 cut(s) 56
AspS9I GGNCC 1 cut(s) 99
AvaII GGWCC 1 cut(s) 99
BbsI GAAGAC 1 cut(s) 155
BfaI CTAG 1 cut(s) 111
BglII AGATCT 1 cut(s) 113
Bme18I GGWCC 1 cut(s) 99
BmgT120I GGNCC 1 cut(s) 99
BpiI GAAGAC 1 cut(s) 155
BsaJI CCNNGG 1 cut(s) 30
Bsc4I CCNNNNNNNGG 2 cut(s) 21, 70
BseDI CCNNGG 1 cut(s) 30
BseLI CCNNNNNNNGG 2 cut(s) 21, 70
BseRI GAGGAG 2 cut(s) 153, 156
BshFI GGCC 1 cut(s) 58
BslI CCNNNNNNNGG 2 cut(s) 21, 70
BsnI GGCC 1 cut(s) 58
Bsp143I GATC 2 cut(s) 85, 113
BspANI GGCC 1 cut(s) 58
BssECI CCNNGG 1 cut(s) 30
BssMI GATC 2 cut(s) 85, 113
BssT1I CCWWGG 1 cut(s) 30
BstAPI GCANNNNNTGC 1 cut(s) 26
BstKTI GATC 2 cut(s) 88, 116
BstMBI GATC 2 cut(s) 85, 113
BstMWI GCNNNNNNNGC 1 cut(s) 26
BstV2I GAAGAC 1 cut(s) 155
BstX2I RGATCY 1 cut(s) 113
BstYI RGATCY 1 cut(s) 113
BsuRI GGCC 1 cut(s) 58
Cfr13I GGNCC 1 cut(s) 99
CviJI RGCY 1 cut(s) 58
CviKI_1 RGCY 1 cut(s) 58
DpnI GATC 2 cut(s) 87, 115
DpnII GATC 2 cut(s) 85, 113
Eco130I CCWWGG 1 cut(s) 30
Eco47I GGWCC 1 cut(s) 99
EcoT14I CCWWGG 1 cut(s) 30
ErhI CCWWGG 1 cut(s) 30
FaiI YATR 1 cut(s) 17
FspBI CTAG 1 cut(s) 111
HaeIII GGCC 1 cut(s) 58
HinfI GANTC 1 cut(s) 129
Hpy188I TCNGA 1 cut(s) 65
HpyAV CCTTC 1 cut(s) 90
HpyCH4IV ACGT 1 cut(s) 37
HpyF10VI GCNNNNNNNGC 1 cut(s) 26
HpySE526I ACGT 1 cut(s) 37
Kzo9I GATC 2 cut(s) 85, 113
MaeI CTAG 1 cut(s) 111
MaeII ACGT 1 cut(s) 37
MalI GATC 2 cut(s) 87, 115
MboI GATC 2 cut(s) 85, 113
MboII GAAGA 2 cut(s) 105, 160
MflI RGATCY 1 cut(s) 113
MmeI TCCRAC 1 cut(s) 88
MnlI CCTC 3 cut(s) 48, 131, 134
MwoI GCNNNNNNNGC 1 cut(s) 26
NdeII GATC 2 cut(s) 85, 113
PfeI GAWTC 1 cut(s) 129
PspPI GGNCC 1 cut(s) 99
PsuI RGATCY 1 cut(s) 113
Sau3AI GATC 2 cut(s) 85, 113
Sau96I GGNCC 1 cut(s) 99
SetI ASST 1 cut(s) 40
SgeI CNNG 8 cut(s) 33, 43, 48, 82, 101, 123, 129, 137
SinI GGWCC 1 cut(s) 99
SspMI CTAG 1 cut(s) 111
StyI CCWWGG 1 cut(s) 30
TaiI ACGT 1 cut(s) 40
TaqI TCGA 1 cut(s) 132
TaqII GACCGA 1 cut(s) 116
TfiI GAWTC 1 cut(s) 129
VpaK11BI GGWCC 1 cut(s) 99
XspI CTAG 1 cut(s) 111
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.