FvH4_6g18041

NLI interacting factor-like phosphatase

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb6
Physical Location & Seq
Forward (+)
11851167 .. 11851622
456 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_6g18041.t1

Sequence Viewer

Length: 294 bp
ATGGGGAAATACTCTTCTCTGAACACCAAGGCTCTGCTAAACCCGGCTCACACAGCCATCTTTCCTGATGAATACAAGGTTGACCAAGTTGATGATAAGGCTTTAGTGAGCAAAGCGTCATTAGGTCCTAATGGGGAGTTGAGGCTTTACTTGGAGGGACTTGCAGATGCTGATGATGTTACTTCTTATGTTAAAGAAAATCCATTTGGACAGCCAGCAATATCAACTACTCACTCTGATTGGGAGTTTTATTTAAAGATCATCAATGCTATTGAGCTTGAGACATTCAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

98

Amino Acids

10.78

Weight (kDa)

4.69

Isoelectric Point (pI)

14.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 289
AjuI GAANNNNNNNTTGG 2 cut(s) 189, 221
AluBI AGCT 1 cut(s) 277
AluI AGCT 1 cut(s) 277
Alw26I GTCTC 1 cut(s) 275
AlwNI CAGNNNCTG 1 cut(s) 170
AspS9I GGNCC 1 cut(s) 125
AsuC2I CCSGG 1 cut(s) 44
AvaII GGWCC 1 cut(s) 125
BccI CCATC 1 cut(s) 65
BcnI CCSGG 1 cut(s) 44
BcoDI GTCTC 1 cut(s) 275
Bme1390I CCNGG 1 cut(s) 44
Bme18I GGWCC 1 cut(s) 125
BmgT120I GGNCC 1 cut(s) 125
BmrFI CCNGG 1 cut(s) 44
BmsI GCATC 1 cut(s) 157
BpuMI CCSGG 1 cut(s) 44
BsaJI CCNNGG 1 cut(s) 27
BseDI CCNNGG 1 cut(s) 27
BsiSI CCGG 1 cut(s) 44
BslFI GGGAC 1 cut(s) 171
BsmAI GTCTC 1 cut(s) 275
BsmFI GGGAC 1 cut(s) 171
Bsp143I GATC 1 cut(s) 258
BssECI CCNNGG 1 cut(s) 27
BssMI GATC 1 cut(s) 258
BssT1I CCWWGG 1 cut(s) 27
Bst6I CTCTTC 1 cut(s) 19
BstC8I GCNNGC 1 cut(s) 216
BstKTI GATC 1 cut(s) 261
BstMAI GTCTC 1 cut(s) 275
BstMBI GATC 1 cut(s) 258
BstMWI GCNNNNNNNGC 1 cut(s) 53
BstSCI CCNGG 1 cut(s) 42
Cac8I GCNNGC 1 cut(s) 216
CaiI CAGNNNCTG 1 cut(s) 170
Cfr13I GGNCC 1 cut(s) 125
CseI GACGC 1 cut(s) 105
CviJI RGCY 7 cut(s) 32, 47, 56, 101, 145, 214, 277
CviKI_1 RGCY 7 cut(s) 32, 47, 56, 101, 145, 214, 277
DpnI GATC 1 cut(s) 260
DpnII GATC 1 cut(s) 258
DraI TTTAAA 1 cut(s) 255
Eam1104I CTCTTC 1 cut(s) 19
EarI CTCTTC 1 cut(s) 19
Eco130I CCWWGG 1 cut(s) 27
Eco47I GGWCC 1 cut(s) 125
EcoO109I RGGNCCY 1 cut(s) 125
EcoT14I CCWWGG 1 cut(s) 27
ErhI CCWWGG 1 cut(s) 27
FaiI YATR 1 cut(s) 189
FaqI GGGAC 1 cut(s) 171
HapII CCGG 1 cut(s) 44
HgaI GACGC 1 cut(s) 105
HincII GTYRAC 1 cut(s) 82
HindII GTYRAC 1 cut(s) 82
HpaII CCGG 1 cut(s) 44
Hpy166II GTNNAC 1 cut(s) 82
Hpy188I TCNGA 2 cut(s) 21, 238
Hpy188III TCNNGA 1 cut(s) 65
Hpy8I GTNNAC 1 cut(s) 82
HpyCH4V TGCA 1 cut(s) 164
HpyF10VI GCNNNNNNNGC 1 cut(s) 53
Kzo9I GATC 1 cut(s) 258
LpnPI CCDG 3 cut(s) 57, 78, 228
LweI GCATC 1 cut(s) 157
MaeIII GTNAC 1 cut(s) 178
MalI GATC 1 cut(s) 260
MboI GATC 1 cut(s) 258
MboII GAAGA 1 cut(s) 6
MnlI CCTC 2 cut(s) 135, 148
MseI TTAA 2 cut(s) 192, 254
MspI CCGG 1 cut(s) 44
MspR9I CCNGG 1 cut(s) 44
MwoI GCNNNNNNNGC 1 cut(s) 53
NciI CCSGG 1 cut(s) 44
NdeII GATC 1 cut(s) 258
PpuMI RGGWCCY 1 cut(s) 125
Psp5II RGGWCCY 1 cut(s) 125
PspPI GGNCC 1 cut(s) 125
PspPPI RGGWCCY 1 cut(s) 125
PstNI CAGNNNCTG 1 cut(s) 170
SaqAI TTAA 2 cut(s) 192, 254
Sau3AI GATC 1 cut(s) 258
Sau96I GGNCC 1 cut(s) 125
ScrFI CCNGG 1 cut(s) 44
SetI ASST 3 cut(s) 81, 127, 279
SfaNI GCATC 1 cut(s) 157
SinI GGWCC 1 cut(s) 125
SmlI CTYRAG 1 cut(s) 278
SmoI CTYRAG 1 cut(s) 278
StyD4I CCNGG 1 cut(s) 42
StyI CCWWGG 1 cut(s) 27
Tru1I TTAA 2 cut(s) 192, 254
Tru9I TTAA 2 cut(s) 192, 254
TspDTI ATGAA 1 cut(s) 84
VpaK11BI GGWCC 1 cut(s) 125
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.